
Forum dédié aux énigmes et à toutes formes de jeux de logique.


Tu n'es pas identifié sur Prise2tete : s'identifier.

accueil Accueil forum Forum

 #1 - 07-02-2013 20:49:44

Elite de Prise2Tete
Enigmes résolues : 45
Messages : 1947
Lieu: Paris

Cryptooban 8 : Dé-codons !

Bonsoir, je vous propose une nouvelle énigme aujourd'hui. Il s'agit d'un message crypté à l'aide d'un code que je me suis permis de modifier.

Voici le message :


Sachant que j'ai voté pour un avocat qui est léger et fessé. (A prendre phonétiquement.)

La case réponse valide des mots collés en majuscule ou en minuscule avec ou sans accents .

Voilà et Bonne chance !

P.S : Spoiler : [Afficher le message] Pour la réponse complète, voir celles de langelotdulac et de SHTF47.

Annonces sponsorisées :

Réponse :
  • |
  • Répondre

#0 Pub

 #2 - 07-02-2013 23:47:29

Elite de Prise2Tete
Enigmes résolues : 48
Messages : 1433
Lieu: Coutiches

Crytoban 8 : Dé-codons !

Je suppose que :
G devient T (G vaut T)
K devient A (A vaut K)
L devient G (L est G)
F devient C (F est C)

J'obtient un code en langage ADN : GTCACTCTCAGCTAGCCTTTGTAAAAATATCTCCGTCTATTA mais qui ne me donne rien même traduit pas Dcode...

 #3 - 08-02-2013 10:32:12

Ange de Prise2Tete
Enigmes résolues : 49
Messages : 2963
Lieu: Paradis

Cryptobn 8 : Dé-codons !

Salut  smile

En suivant ton avocat coquin et masochiste, je découvre que :
G vaut T
A vaut K
L est G
F est C

Ce qui me donne : 

Une suite adn qui après transcription en ARN et traduction de celui-ci en protéines, devient :

Acide DésoxyriboNucléique

Joli !

Nulle en biologie, mais heureusement pour moi, j'avais déjà vu ça quelque part lol

Merci smile

Tu es largement assez dingo pour qu'un Minito te semble cohérent \o/ !

 #4 - 08-02-2013 10:42:25

Imprnnçbl de Prs2Tt
Enigmes résolues : 39
Messages : 1629
Lieu: Autre nom du colin

Cryptoban 8 : éD-codons !

Le titre fait penser aux codons de l'ADN (TGAC)

J'ai voté --> G=T
Avocat --> A=K
est léger --> L=G
et fessé --> F=C

En remplaçant dans le message codé, on obtient :


Avec dcode, il faut dans un premier temps transcrire la séquence ADN en ARN (on dit transcrivez, pas transcripter pffff roll), ce qui nous donne :


La séquence ARN devient alors par déchiffrage :


Et la réponse est : Aberration De Nature

Mais ça ne marche pas dans la case réponse !!! mad

Tu as sans doute marqué une connerie du genre acide désoxyribonucléique... sans déconner...

La musique est une mathématique sonore, la mathématique une musique silencieuse. [Edouard HERRIOT]

 #5 - 08-02-2013 13:06:09

Elite de Prise2Tete
Enigmes résolues : 45
Messages : 1947
Lieu: Paris

Cryptoban 8 : Dé-codonns !

Bravo à langelotdulac !
Pour les deux autres, transcrivez (si ça existe comme verbe) la base que vous utilisez.
Spoiler : [Afficher le message] Dcode peut vous aider, il faut juste chercher au bon endroit sur la bonne page.

 #6 - 08-02-2013 13:55:46

Elite de Prise2Tete
Enigmes résolues : 49
Messages : 1355

Cryptoban 8 : Dé-cdoons !


K=A  L=G   F=C   G=T


on prend le complentaire ?? Pourquoi ...hmm


on traduit

QUE SIGNIFIE ADN ?    Avec le 2eme codon, un stop TGA modifié

donc la réponse est
Acide DésoxyriboNucléique

Merci Sympa:)

 #7 - 08-02-2013 19:34:36

Elite de Prise2Tete
Enigmes résolues : 45
Messages : 1947
Lieu: Paris

Crytpoban 8 : Dé-codons !

Toutes mes félicitations à nobodydy qui prend la deuxième place !

 #8 - 10-02-2013 11:57:58

Elite de Prise2Tete
Enigmes résolues : 49
Messages : 5,734E+3

Crytoban 8 : Dé-codons !



On regroupe en triplets :

On transcrit en ARN :

On teste sur dcode :
V T L S (FIN) P L (FIN) K Y L R L L ?
F T L I Y P F (FIN) K Y L L L L ?

C'est un peu bof...

On tente la réplique :

Q U E S I G N I F I E A D N ?

Et hop, un petit coup d'acide désoxyribonucléique

 #9 - 10-02-2013 12:08:28

Elite de Prise2Tete
Enigmes résolues : 45
Messages : 1947
Lieu: Paris

cryptoban 8 : dé-codond !

Bravo gwen !

 #10 - 10-02-2013 23:34:35

Expert de Prise2Tete
Enigmes résolues : 42
Messages : 856

vryptoban 8 : dé-codons !

Quelques conversions (difficiles à trouver sans l'indice) :
G --> T
K --> A
L --> G
F --> C
Une transcription des codons ADN en ARN, puis une traduction des codons ARN nous donne:
Que signifie ADN ?
Réponse: Acide Desoxyribo Nucléïque.

Merci Saban smile

Rendez les choses aussi simples que possible, mais pas plus simples. Albert Einstein

 #11 - 11-02-2013 13:20:36

Elite de Prise2Tete
Enigmes résolues : 45
Messages : 1947
Lieu: Paris

cryptoban 8 : dé-codonq !

De rien, j'avoue l'indice n'est pas vraiment un indice puisqu'il est quasi-nécessaire pour la résolution de l'énigme. Je l'ai mis en indice parce que je ne savais pas quoi mettre en indice c'est tout. En tout cas, bravo elpafio.

 #12 - 12-02-2013 18:02:25

Elite de Prise2Tete
Enigmes résolues : 49
Messages : 1290
Lieu: La vieille ouvrière de F.Bobin

Crypptoban 8 : Dé-codons !


G vaut T, A vaut K, L est G et F est C.

Les quatre nucléotides transformés:

Une fois traduit:
Que signifie ADN: Acide désoxyribonucléique.


 #13 - 12-02-2013 18:05:52

Elite de Prise2Tete
Enigmes résolues : 45
Messages : 1947
Lieu: Paris

cryptonan 8 : dé-codons !

Bravo ravachol ! Auriez-vous le courage d'aller affronter Cryptoban 9 ???


Réponse rapide

Rédige ton message
| | | | Upload | Aide
:) :| :( :D :o ;) :/ :P :lol: :mad: :rolleyes: :cool:

Répondez à la devinette suivante : 

Le père de toto a trois fils : Pim, Pam et ?

Sujets similaires

Mots clés des moteurs de recherche

Mot clé (occurences)

Pied de page des forums

P2T basé sur PunBB
Screenshots par Robothumb

© Copyright 2002–2005 Rickard Andersson

Prise2Tete Forum Statistiques Liste des membres Hall of Fame Contact
© Prise2tete - Site d'énigmes et de réflexion.
Un jeu où seules la réflexion, la logique et la déduction permettent de trouver la solution.

Flux RSS de Prise2Tete Forum Jeux & Prise2Tete Test & Prise2Tete Partenariat et Publicité sur Prise2Tete