Enigmes

Forum dédié aux énigmes et à toutes formes de jeux de logique.

Déconnexion

Tu n'es pas identifié sur Prise2tete : s'identifier.

accueil Accueil forum Forum
[+]

 #1 - 07-02-2013 20:49:44

SabanSuresh
Elite de Prise2Tete
Enigmes résolues : 45
Messages : 1945
Lieu: Paris

Cryptoban : Dé-codons !

Bonsoir, je vous propose une nouvelle énigme aujourd'hui. Il s'agit d'un message crypté à l'aide d'un code que je me suis permis de modifier.

Voici le message :

LGFKFGFGFKLFGKLFFGGGLGKKKKKGKGFGFFLGFGKGGK ?

Sachant que j'ai voté pour un avocat qui est léger et fessé. (A prendre phonétiquement.)

La case réponse valide des mots collés en majuscule ou en minuscule avec ou sans accents .

Voilà et Bonne chance !

P.S : Spoiler : [Afficher le message] Pour la réponse complète, voir celles de langelotdulac et de SHTF47.



Annonces sponsorisées :

 
Réponse :
  • |
  • Répondre

#0 Pub

 #2 - 07-02-2013 23:47:29

golgot59
Elite de Prise2Tete
Enigmes résolues : 48
Messages : 1374
Lieu: Coutiches

cryptoban 8 : dé-codobs !

Je suppose que :
G devient T (G vaut T)
K devient A (A vaut K)
L devient G (L est G)
F devient C (F est C)

J'obtient un code en langage ADN : GTCACTCTCAGCTAGCCTTTGTAAAAATATCTCCGTCTATTA mais qui ne me donne rien même traduit pas Dcode...

 #3 - 08-02-2013 10:32:12

langelotdulac
Ange de Prise2Tete
Enigmes résolues : 49
Messages : 2963
Lieu: Paradis

crypyoban 8 : dé-codons !

Salut  smile

En suivant ton avocat coquin et masochiste, je découvre que :
G vaut T
A vaut K
L est G
F est C

Ce qui me donne : 
GTC - ACT - CTC - AGC - TAG - CCT - TTG - TAA - AAA - TAT - CTC - CGT - CTA - TTA

Une suite adn qui après transcription en ARN et traduction de celui-ci en protéines, devient :
CAG = Q
UGA = U
GAG = E
UCG = S
AUC = I
GGA = G
AAC = N
AUU = I
UUU = F
AUA = I
GAG = E
GCA = A
GAU = D
AAU = N

Acide DésoxyriboNucléique

Joli !

Nulle en biologie, mais heureusement pour moi, j'avais déjà vu ça quelque part lol

Merci smile


Tu es largement assez dingo pour qu'un Minito te semble cohérent \o/ !

 #4 - 08-02-2013 10:42:25

SHTF47
Imprnnçbl de Prs2Tt
Enigmes résolues : 39
Messages : 1629
Lieu: Autre nom du colin

Cryptoban 8 : Déc-odons !

Le titre fait penser aux codons de l'ADN (TGAC)

J'ai voté --> G=T
Avocat --> A=K
est léger --> L=G
et fessé --> F=C

En remplaçant dans le message codé, on obtient :

GTCACTCTCAGCTAGCCTTTGTAAAAATATCTCCGTCTATTA

Avec dcode, il faut dans un premier temps transcrire la séquence ADN en ARN (on dit transcrivez, pas transcripter pffff roll), ce qui nous donne :

CAGUGAGAGUCGAUCGGAAACAUUUUUAUAGAGGCAGAUAAU

La séquence ARN devient alors par déchiffrage :

QUESIGNIFIEADN

Et la réponse est : Aberration De Nature

Mais ça ne marche pas dans la case réponse !!! mad

Tu as sans doute marqué une connerie du genre acide désoxyribonucléique... sans déconner...


La musique est une mathématique sonore, la mathématique une musique silencieuse. [Edouard HERRIOT]

 #5 - 08-02-2013 13:06:09

SabanSuresh
Elite de Prise2Tete
Enigmes résolues : 45
Messages : 1945
Lieu: Paris

Cryptoban 8 : Dé-coons !

Bravo à langelotdulac !
Pour les deux autres, transcrivez (si ça existe comme verbe) la base que vous utilisez.
Spoiler : [Afficher le message] Dcode peut vous aider, il faut juste chercher au bon endroit sur la bonne page.

 #6 - 08-02-2013 13:55:46

nobodydy
Elite de Prise2Tete
Enigmes résolues : 49
Messages : 1286

Cryptoban : Dé-codons !

LGFKFGFGFKLFGKLFFGGGLGKKKKKGKGFGFFLGFGKGGK

K=A  L=G   F=C   G=T

GTCACTCTCAGCTAGCCTTTGTAAAAATATCTCCGTCTATTA

on prend le complentaire ?? Pourquoi ...hmm

CAGTGAGAGTCGATCGGAAACATTTTTATAGAGGCAGATAAT

on traduit

QUE SIGNIFIE ADN ?    Avec le 2eme codon, un stop TGA modifié

donc la réponse est
Acide DésoxyriboNucléique


Merci Sympa:)

 #7 - 08-02-2013 19:34:36

SabanSuresh
Elite de Prise2Tete
Enigmes résolues : 45
Messages : 1945
Lieu: Paris

Cryptoban 8 : Déé-codons !

Toutes mes félicitations à nobodydy qui prend la deuxième place !

 #8 - 10-02-2013 11:57:58

gwen27
Elite de Prise2Tete
Enigmes résolues : 49
Messages : 5,464E+3

Cryptoban 8 : Dé-codoons !

LGFKFGFGFKLFGKLFFGGGLGKKKKKGKGFGFFLGFGKGGK ?

G vaut T : LTFKFTFTFKLFTKLFFTTTLTKKKKKTKTFTFFLTFTKTTK ?
A vaut K : LTFAFTFTFALFTALFFTTTLTAAAAATATFTFFLTFTATTA ?
F est C :   LTCACTCTCALCTALCCTTTLTAAAAATATCTCCLTCTATTA ?
L est G : GTCACTCTCAGCTAGCCTTTGTAAAAATATCTCCGTCTATTA ?
Ou bien : TTCACTCTCATCTATCCTTTTTAAAAATATCTCCTTCTATTA ?


On regroupe en triplets :
GTC ACT CTC AGC TAG CCT TTG TAA AAA TAT CTC CGT CTA TTA ?
TTC ACT CTC ATC TAT CCT TTT TAA AAA TAT CTC CTT CTA TTA ?

On transcrit en ARN :
GUC ACU CUC AGC UAG CCU UUG UAA AAA UAU CUC CGU CUA UUA ?
UUC ACU CUC AUC UAU CCU UUU UAA AAA UAU CUC CUU CUA UUA ?

On teste sur dcode :
V T L S (FIN) P L (FIN) K Y L R L L ?
F T L I Y P F (FIN) K Y L L L L ?

C'est un peu bof...

On tente la réplique :
CAG UGA GAG UCG AUC GGA AAC AUU UUU AUA GAG GCA GAU AAU ?
AAG UGA GAG UAG AUA GGA AAA AUU UUU AUA GAG GAA GAU AAU ?

Q U E S I G N I F I E A D N ?

Et hop, un petit coup d'acide désoxyribonucléique
http://us.123rf.com/400wm/400/400/molekuul/molekuul1203/molekuul120300008/12857406-adn-structure-3d-l-39-adn-est-le-support-principal-de-l-39-information-genetique-dans-tous-les-organ.jpg

 #9 - 10-02-2013 12:08:28

SabanSuresh
Elite de Prise2Tete
Enigmes résolues : 45
Messages : 1945
Lieu: Paris

Cryptoban 8 : Dé-coodns !

Bravo gwen !

 #10 - 10-02-2013 23:34:35

elpafio
Expert de Prise2Tete
Enigmes résolues : 42
Messages : 828

Cyptoban 8 : Dé-codons !

Quelques conversions (difficiles à trouver sans l'indice) :
G --> T
K --> A
L --> G
F --> C
Une transcription des codons ADN en ARN, puis une traduction des codons ARN nous donne:
Que signifie ADN ?
Réponse: Acide Desoxyribo Nucléïque.

Merci Saban smile


Rendez les choses aussi simples que possible, mais pas plus simples. Albert Einstein

 #11 - 11-02-2013 13:20:36

SabanSuresh
Elite de Prise2Tete
Enigmes résolues : 45
Messages : 1945
Lieu: Paris

cryptobzn 8 : dé-codons !

De rien, j'avoue l'indice n'est pas vraiment un indice puisqu'il est quasi-nécessaire pour la résolution de l'énigme. Je l'ai mis en indice parce que je ne savais pas quoi mettre en indice c'est tout. En tout cas, bravo elpafio.

 #12 - 12-02-2013 18:02:25

ravachol
Elite de Prise2Tete
Enigmes résolues : 49
Messages : 1278
Lieu: La vieille ouvrière de F.Bobin

Cryptoban 8 : Dé-coodons !

Salut,

G vaut T, A vaut K, L est G et F est C.
GTC ACT CTC AGC TAG CCT TTG TAA AAA TAT CTC CGT CTA TTA.

Les quatre nucléotides transformés:
CAG UGA GAG UCG AUC GGA AAC AUU UUU AUA GAG GCA GAU AAU.

Une fois traduit:
Que signifie ADN: Acide désoxyribonucléique.

smile

 #13 - 12-02-2013 18:05:52

SabanSuresh
Elite de Prise2Tete
Enigmes résolues : 45
Messages : 1945
Lieu: Paris

Crypttoban 8 : Dé-codons !

Bravo ravachol ! Auriez-vous le courage d'aller affronter Cryptoban 9 ???

 

Réponse rapide

Rédige ton message
| | | | Upload | Aide
:) :| :( :D :o ;) :/ :P :lol: :mad: :rolleyes: :cool:
Sécurité

Répondez (numériquement) à la petite énigme suivante : 

Un berger a 30 moutons, ils meurent tous sauf 15, combien en reste-t-il ?

Sujets similaires

Mots clés des moteurs de recherche

Mot clé (occurences)

Pied de page des forums

P2T basé sur PunBB
Screenshots par Robothumb

© Copyright 2002–2005 Rickard Andersson

Prise2Tete Forum Statistiques Liste des membres Hall of Fame Contact
© Prise2tete - Site d'énigmes et de réflexion.
Un jeu où seules la réflexion, la logique et la déduction permettent de trouver la solution.

Flux RSS de Prise2Tete Forum Jeux & Prise2Tete Test & Prise2Tete Partenariat et Publicité sur Prise2Tete