Enigmes

Forum dédié aux énigmes et à toutes formes de jeux de logique.

Déconnexion

Tu n'es pas identifié sur Prise2tete : s'identifier.

accueil Accueil forum Forum
[+]

 #1 - 19-03-2013 16:27:20

nobodydy
Elite de Prise2Tete
Enigmes résolues : 49
Messages : 1286

EEnigme n°4 : Mine et Ro

Petit décryptage classique (au début)

la réponse est en minuscule.




Si problème, le MP est ouvert



Annonces sponsorisées :

 
Réponse :
  • |
  • Répondre

#0 Pub

 #2 - 19-03-2013 18:22:01

Moriss
Professionnel de Prise2Tete
Enigmes résolues : 37
Messages : 460

Enigme n°4 : Minne et Ro

La traduction de cette chaîne de codons nucléotidiques en initiales d'acides aminés me donne :
ACC GGA GCA TGT ACA

Je m'aperçois que je peux de nouveau les "traduire" :
TGA CT

TGA est un codon "stop", ce qui peut expliquer le panneau du dessin. Mais je ne vois pas le rapport avec un quelconque minéral. sad

 #3 - 19-03-2013 20:05:11

nobodydy
Elite de Prise2Tete
Enigmes résolues : 49
Messages : 1286

Enigme n°4 : iMne et Ro

Excellent début
vous y est presque. wink

Evidemment, le décryptage ADN n'a aucun secret pour personne, surtout ici.
mais ce n'est pas la solution directe. Cela aurait été trop facile. lollollol

Courage...smile

 #4 - 19-03-2013 20:17:33

SabanSuresh
Elite de Prise2Tete
Enigmes résolues : 45
Messages : 1945
Lieu: Paris

Enigme n°4 : Mine e tRo

Je traduit l'ADN en ARN (pour utiliser les codons) et je trouve GCA ACA ACG CCA CCC CGU CCU ACG CGG UGU CCU UGG CGA ACG CGU puis Ala Thr Thr Pro Pro Arg Pro Thr Arg Cys Pro Trp Arg Thr Arg et en prenant les initiales A T T P P R P T R C P W R T R et là je bloque. Suis-je en train de poursuivre une mauvaise piste ou faut-il faire quelque chose supplémentaire ?

 #5 - 20-03-2013 10:54:50

Klimrod
Elite de Prise2Tete
Enigmes résolues : 40
Messages : 3758
Lieu: hébesphénorotonde triangulaire

Enigme n4° : Mine et Ro

Bonjour,

Impossible de trouver l'origine de cette image, ainsi que la raison du panneau STOP, qui n'est certainement pas là par hasard !
big_smile

Les codons ADN, si c'en sont, se traduisent en codons ARN, puis en texte clair :
ADN : GCTTGTTGCGGTGGGGCAGGATGCGCCACAGGAACCGCTTGCGCA
ARN : CGAACAACGCCACCCCGUCCUACGCGGUGUCCUUGGCGAACGCGU
texte clair : RTTPPRPTRCPWRTR  roll roll roll

Il faudrait également utiliser les syllabes MINE et RO, mais comment ?
Bref, beaucoup d'inconnues et peu d'idées pour la réponse...

smile Klim.


J'ai tant besoin de temps pour buller qu'il n'en reste plus assez pour bosser. Qui vit sans folie n'est pas si sage qu'il croit.

 #6 - 20-03-2013 11:19:13

nobodydy
Elite de Prise2Tete
Enigmes résolues : 49
Messages : 1286

Enigme n°4 : Mine et R

Mine et ro, ce n'était qu'un jeu de mot pour Minéraux
donc ne rien faire avec.

Il n'y a pas besoin de passer par l'ADN complémentaire
(pour info, et juste pour info, lol, l'adn est double brin, la transcription en ARN ce fait toujours à partir de l'ADN complementaire. Donc le complementaire du complementaire redonne le brin principal. Soit si vous avez un ATG, l'ARN donnera AUG)

c'est bien de l'ADN sur la photo, c'est le brin principal, donc pas besoin de passer par un ADN complémentaire ou autre, pour traduire en acide aminé

Sinon sur l'origine de la photo, ce sont des volcans d'Auvergne.
et oui le STOP n'est pas la par hasard.

Nobo wink

 #7 - 20-03-2013 13:15:23

Klimrod
Elite de Prise2Tete
Enigmes résolues : 40
Messages : 3758
Lieu: hébesphénorotonde triangulaire

rnigme n°4 : mine et ro

Bon.
Je n'ai pas compris grand chose, à part le fait qu'il faut changer les T en U pour passer de l'ADN à l'ARN.

ADN : GCT TGT TGC GGT GGG GCA GGA TGC GCC ACA GGA ACC GCT TGC GCA
ARN : GCU UGU UGC GGU GGG GCA GGA UGC GCC ACA GGA ACC GCU UGC GCA
Traduction : A C C G G A G C A T G T A C A = ACC GGA GCA TGT ACA

ACC = Thréonine = T
GGA = Glycine = G
GCA = Alanine = A
TGT = UGU = Cystéine = C
ACA = Thréonine = T

Donc nouvelle traduction = TGACT roll

Pour la suite, si je décalle les lettres de -2 : REYAR, puis si j'inverse le mot : RAYER.
Ceci est ma réponse, et c'est mon dernier mot ! big_smile
Klim.

[Edit] Après mp pour débloquer, TGA-CT en ADN devient UGA-CU en ARN, et ça démarre par le codon-stop UGA, qui code qui code la sélénocystéine et que l'on appelle opale ou ombre.
Les deux autres codons-stops sont UAA (ocre) et UAG (ambre).

Il faut donc retenir le mot OPALECU ou OMBRECU.
En fait, c'est OPALE-CT qu'il faut retenir. Il s'agit d'un mélange d'opale de cristobalite et de tridymite, qui apparaît sous forme de lépisphères. Parfois cette opale-CT est appelée lussatite.

D'après ce que j'ai compris, la lussatite est une opale quasiment endémique au Massif-Central (Lussat est une ville du Puy-de-Dôme), dans laquelle on peut trouver des fossiles comme cet helix ramondi :
http://tempsjadis.kazeo.com/sites/fr/photos/326/helix-ramondi-en-lussatite_3260962-L.jpg

Bravo et merci pour cette énigme.
C'est fort et c'est pour spécialistes...
Klim.


J'ai tant besoin de temps pour buller qu'il n'en reste plus assez pour bosser. Qui vit sans folie n'est pas si sage qu'il croit.

 #8 - 20-03-2013 15:00:14

nobodydy
Elite de Prise2Tete
Enigmes résolues : 49
Messages : 1286

Enigme n°4 : Min eet Ro

Félicitation à Klimrod smile
qui s'est un peu compliqué la tache en passant par l'ARN, mais c'est un peu de ma faute. Ce n'est qu'un cryptage ADN ! (pour jouer...)

et merci wink

Ps : Crois tu vraiment que ce soit pour spécialistes ? lol

 #9 - 20-03-2013 15:31:15

gwen27
Elite de Prise2Tete
Enigmes résolues : 49
Messages : 5,464E+3

Enigme n°4 : Mne et Ro

GCUUGUUGCGGUGGGGCAGGAUGCGCCACAGGAACCGCA

Donnent :

ACCGGAGCATGTACA

Qui donne :

ACCGGAGCAUGUACA

qui donne :

TGACT  Bof....  UGACU ? PUY STOP ?

Les trois codons-stop sont :
UAA (ocre)
UAG (ambre), pouvant coder la pyrrolysine
UGA (opale ou ombre), pouvant coder la sélénocystéine

UGA (opale) CU (Cuivre ? Et encore un stop ?   Je chercherai un peu plus tard smile

Oups, je l'avais oubliée en chemin celle-ci...

L'Opal-CT ou Lussatite du nom du village topotype  d'Auvergne où elle fut découverte et décrite par  François Ernest Mallard.

http://upload.wikimedia.org/wikipedia/commons/thumb/2/2b/Lussatite-France.jpg/758px-Lussatite-France.jpg

 #10 - 20-03-2013 16:10:08

nobodydy
Elite de Prise2Tete
Enigmes résolues : 49
Messages : 1286

Enigme n°4 :Mine et Ro

Tu y es presque Gwen, un google et tu as fini.wink

A tous ! laisser tomber le coté ARN,  un ATG est une méthionine, ceci est un exemple bien sur. Ce n'est q'un jeu. un T reste un T (pas de U) smilesmile

j'ai expliqué l'ARN car certains ont transcrit ADN en ARN en prenant le complémentaire sad j'aurai mieux fait de me taire..lollol

 #11 - 20-03-2013 18:21:41

Moriss
Professionnel de Prise2Tete
Enigmes résolues : 37
Messages : 460

Enigme n°°4 : Mine et Ro

Suite de mon post :
On a TGA CT

Un MP de nobodydy (merci smile) m'indique que ce codon a un autre nom que "stop".
En effet, il s'appelle "opal". Et un célèbre moteur de recherche m'indique que l'opal CT existe :
Opal-CT (la lussatite des francophones) composée de Cristobalite et de Tridymite (d’où les deux lettre « C » et « T »). (wiki)

Merci wiki wink ; la réponse est donc lussatite !

 #12 - 21-03-2013 09:17:19

nobodydy
Elite de Prise2Tete
Enigmes résolues : 49
Messages : 1286

Enigme n°4 : ine et Ro

Et de deux
Bravo à Moriss
un départ sans faute, une pause, et un fin parfaite. wink

 #13 - 23-03-2013 15:07:31

elpafio
Expert de Prise2Tete
Enigmes résolues : 42
Messages : 828

Enigme n°4 : Mine et Roo

Bonjour,

Il s'agirait apparemment d'une suite de 15 codons ADN:
GCT TGT TGC GGT GGG GCA GGA TGC GCC ACA GGA ACC GCT TGC GCA

Le panneau Stop pourrait faire penser qu'on doit trouver un codon stop.
TGA TAG ou TAA ?
Aucun de ces trois-là ne figure dans la liste des 15 codons.
Ou qu'on doit s'arrêter à "GCT TGT TGC GGT GG" stop ?

nobodydy a écrit:

c'est bien de l'ADN sur la photo, c'est le brin principal, donc pas besoin de passer par un ADN complémentaire ou autre, pour traduire en acide aminé

J'évite la transcription des codons ADN en codons ARN.
Mais je suppose qu'on doit quand même traduire quelque chose en acides aminés ?

J'arrive à ceci:
ACCGGAGCATGTACA
Autant dire que je n'arrive pas à grand-chose lol
Seulement 4 lettres différentes hmm
On pourrait considérer qu'il s'agit une nouvelle fois de codons ADN, mais bon...

L'Auvergne, le Cantal, les roches volcaniques, on cherche sans doute le nom d'un minéral...
Mais lequel ? ... Mystère...
Vais donner ma langue au Chat tongue


Rendez les choses aussi simples que possible, mais pas plus simples. Albert Einstein

 #14 - 24-03-2013 18:37:50

nobodydy
Elite de Prise2Tete
Enigmes résolues : 49
Messages : 1286

nEigme n°4 : Mine et Ro

bon pas d'autres explications à donner. cool

l'image saturée en bleu pour le bleu de l'Opal, le "Stop" pour insister sur le stop génétique final , l'Auvergne pour la localisation.

un décryptage classique ADN, puis un Deuxieme; puis un STOP TC, et
l'OPAL TC.   La Lussatite.

En surfant sur le Net,j'ai découvert ce nom, et je pensais qu'un codage ADN était parfait.
J'aurai peut etre du, mieux vous guider sur cette énigme, mais bon, je ferais mieux la prochaine fois. hmm

Merci à tout ceux qui se sont aventurés dans cette énigme. smile

nobodydy

 

Réponse rapide

Rédige ton message
| | | | Upload | Aide
:) :| :( :D :o ;) :/ :P :lol: :mad: :rolleyes: :cool:
Sécurité

Répondez à la devinette suivante : 

Le père de toto a trois fils : Tim, Tam et ?

Sujets similaires

Sujet Date Forum
P2T
Sin Pier Code par SaintPierre
16-06-2011 Enigmes Cryptées
P2T
Message codé par Novalis
23-01-2014 Enigmes Cryptées
P2T
21-10-2014 Enigmes Cryptées
P2T
10-04-2014 Enigmes Cryptées
P2T
Où est le pass ? par Crazyclown
01-11-2009 Enigmes Cryptées
P2T
Amicalement vôtre ! par SaintPierre
20-01-2011 Enigmes Cryptées
16-03-2009 Enigmes Cryptées
P2T
10-02-2013 Enigmes Cryptées
P2T
19-08-2007 Enigmes Cryptées

Mots clés des moteurs de recherche

Mot clé (occurences)
Tageu (1) — Helix ramondi lussatite (1) — Enigme base adn (1) — Aug gca egnime (1) — La lussatite (1) — Adn aug gca (1) — Helix ramondi en lussatite (1) — Adn (1) —

Pied de page des forums

P2T basé sur PunBB
Screenshots par Robothumb

© Copyright 2002–2005 Rickard Andersson

Prise2Tete Forum Statistiques Liste des membres Hall of Fame Contact
© Prise2tete - Site d'énigmes et de réflexion.
Un jeu où seules la réflexion, la logique et la déduction permettent de trouver la solution.

Flux RSS de Prise2Tete Forum Jeux & Prise2Tete Test & Prise2Tete Partenariat et Publicité sur Prise2Tete