Enigmes

Forum dédié aux énigmes et à toutes formes de jeux de logique.

Déconnexion

Tu n'es pas identifié sur Prise2tete : s'identifier.

accueil Accueil forum Forum
[+]

 #1 - 22-07-2008 17:53:51

Taupine
Sage de Prise2Tete
Enigmes résolues : 49
Messages : 1073

aff. pap. saison2 : la cellule se taupine

Voler des œuvres d'art c'est une chose (souvent bien plus facile que ce que s'imaginent leurs propriétaires), assassiner des personnes âgées sans défense en est une autre et Taupine savait qu'aucun des sages n'était capable de cela. Malheureusement ils n'avaient pas pu prouver leur innocence, ils s'étaient bien fait balader durant l'enquête puis lors du procès. Il y avait certainement un complot derrière tout cela, mais il restait encore à le démontrer.

« Et me voilà à moisir dans un cachot, comme une vulgaire criminelle de bas étage ! » pensa Taupine, mécontente, rongeant son frein dans sa cellule sans fenêtre.

Une semaine déjà c'était écoulée, mais ils n'allaient pas moisir ici plus longtemps ! Ils s'étaient tous donné le mot ce midi. Taupine sentait qu'elle allait rapidement regretter les poulet façon Normande au Babybel de la merveilleuse cantine de la prison d'Auch. Limen était parti à l'infirmerie, et il devait bientôt pouvoir désactiver le système de surveillance. Quaramba, JustineF et Taupine guettaient le signal rouge de la caméra du couloir des filles. Tout à coup celle-ci s'écria : « Eh les filles !! Limen a réussi regardez, la caméra s'est éteinte ! Vite, chacune à son énigme ! »

Sur sa porte blindée, Taupine pouvait voir un clavier comportant les lettres de l'alphabet... Elle s'aperçut rapidement qu'elles n'y figuraient pas toutes. Les lettres manquantes étaient B, J, O, U, X et Z. « C'est curieux tout de même ! » se dit-elle « Et cela déverrouille certainement la porte. »

ACDEF
GHIKL
MNPQR
STVWY

Tourner sans relâche en rond dans sa cellule n'avait pas été complètement inutile non plus. En effet, Taupine avait pu remarqué dans un coin, une suite de lettres gravées dans la pierre.

HHUHDDUBBBHDDUDDUHDUUUHDDUDUHBDUDBUD

« hubudbduhhu... » marmonna Taupine « On ne peut pas dire que ce soit très compréhensible tout ça. Hum... un code utilisant seulement 4 lettres permettant d'en coder vingt différentes, cela me rappelle quelque chose... et je suppose qu'il faut donc taper la réponse sur le clavier. »

Taupine entendit Quaramba sortir de sa cellule, puis JustineF. « Taupine, tout va bien ? » lui demanda celle-ci. Taupine tapa trois mots sur le clavier et la porte de sa cellule s'ouvrit...


Spoiler : [Afficher le message] Une première opération très simple sur la suite de lettre peut faire faire un grand pas en avant sur ce système de codage, inventé bien avant l'apparition de l'homme !



Annonces sponsorisées :
  • |
  • Répondre

#0 Pub

 #2 - 22-07-2008 22:12:17

bagouze
Expert de Prise2Tete
Enigmes résolues : 49
Messages : 589
Lieu: Lille

aff. pap. saison2 : la cellume de taupine

Bon ben le schmilblik avance peu...... un petit code césar sur la suite nous donne une série composée de A C G et T qui sont des nucléotides de l'ADN.  Le tableau de 20 lettres correspond à des acides aminés qui sont eux mêmes codés dans l'ADN en codons de 3 nucléotides.  La suite décomposée en succession de codons m'amène pour l'instant à GA*SLLLCL*LI qui ne donne rien, même en lui réappliquant un code césar.   Je cherche mon erreur ou mon oubli........

EDIT.....ok, il faut donc chercher la 2eme séquence de l'ADN, cette séquence une fois décomposée en codons me donnant cette fois PRISEDETETE* ce qui semble ma foi beaucoup plus vraisemblable smile Merci taupine pour l'aiguillage vers la détection de l'oubli big_smile


"Nous sommes tous dans le caniveau, mais certains d'entre nous regardent les étoiles." (O. Wilde)

 #3 - 22-07-2008 22:19:45

emmaenne
Elite de Prise2Tete
Enigmes résolues : 49
Messages : 3057
Lieu: Au sud du Nord

Aff. Pap. Saison2 : La cellulee de Taupine

HHUHDDUBBBHDDUDDUHDUUUHDDUDUHBDUDBUD

code césar

Code ADN-ARN

GGT     GCC     TAA     AGC     CTC     CTG     CTT     TGC     CTC     TGA     CTC     ATC
CCA    CGG     AUU    UCG    GAG     GAC     GAA     ACG     GAG     ACU     GAG     UAG
P    R    I    S    E    D    E    T    E    T    E    Stop


Dans le cadre de la quinzaine du beau langage, ne disez pas disez, disez dites. (Julos Beaucarne)

 #4 - 22-07-2008 22:20:58

MthS-MlndN
Hors d'u-Sage
Enigmes résolues : 49
Messages : 12,414E+3
Lieu: Rouen

Aff. Pap. Saison2 : La cellul ede Taupine

Tordue et superbe ! wink

Alors voici : la suite de lettres HHU HDD UBB BHD DUD DUH DUU UHD DUD UHB DUD BUD nous donne, en descendant d'une lettre :

GGT GCC TAA AGC CTC CTG CTT TGC CTC TGA CTC ATC

Transposition (codage de l'ARN) :

CCA CGG AUU UCG GAG GAC GUU ACG GAG ACU GAG UAG

Soit les protéines :

proline - arginine - isoleucine - sérine - acide glutamique - acide aspartique - valine - thréonine - acide glutamique - thréonine - acide glutamique - stop

Ou encore :

PRISEDVTETE

J'ai dû me tromper quelque part (ou bien c'est toi roll) mais je crois savoir où on doit en venir...


Podcasts Modern Zeuhl : http://radio-r2r.fr/?p=298

 #5 - 22-07-2008 23:26:14

FRiZMOUT
Verbicruciste binairien
Enigmes résolues : 49
Messages : 2209

Aff. Pap. Saison2 : L acellule de Taupine

Nous décodons les codons et découvrons : PRISEDETETE !
Stop.

 #6 - 22-07-2008 23:32:44

nipon
Pro de Prise2Tete
Enigmes résolues : 45
Messages : 816

aff. pap. saison2 : la celkule de taupine

ah ah! je pense à un codage ADN...

si on utilise le code césar en décalant de 1, on a:

GGTGCCTAAAGCCTCCTGCTTTGCCTCTGACTCATC

après, je cherche...

Edit:
Ca y est, j'ai trouvé!
Taupine, je me prosterne!
Ton énigme est superbe, bravissimo!!!big_smile

Spoiler : [Afficher le message]
Je convertis donc la séquence, et j'obtiens:
CCA CGG AUU UCG GAG GAC GAA ACG GAG ACU GAG UAG

Et là, en utilisant le tableau répertoriant le code de chaque acide aminé trouvé là:
http://fr.wikipedia.org/wiki/Code_g%C3%A9n%C3%A9

on obtient le sésame ouvre toi qui m'a bien fait rire:
PRISE DE TETE STOP

Hi! hi! Très drôle et très bien fait, tu mérites ta liberté! lol

 #7 - 23-07-2008 00:53:09

PomaH
Passionné de Prise2Tete
Enigmes résolues : 44
Messages : 55

Aff. Pap. Saison2 : L acellule de Taupine

Partons de la séquence : HHU HDD UBB BHD DUD DUH DUU UHD DUD UHB DUD BUD

Appliquons un petit code Cesar : GGT GCC TAA AGC CTC CTG CTT TGC CTC TGA CTC ATC

Appliquons maintenant le principe des bases azotées : CCA CGG AUU UCG GAG GAC GAA ACG GAG ACU GAG UAG

Et enfin cherchons le code des acides aminés codés par ces codons (jolie allitération en "c" au passage) et on obtient : prisdeetete.

Est-moi qui me suis trompé, pourtant j'ai vérifié plusieurs fois.

Je pense que la réponse est "prise de tete"


Waiting For n°44

 #8 - 23-07-2008 14:26:42

Gadjo
Déconoclaste
Enigmes résolues : 47
Messages : 1619
Lieu: Dans ma roulotte

Aff. Pap. Saison2 : La cellule de Tapuine

Là,Taupine,tu exageres !
Le décalage d'une lettre bon, c'est jouable.
Mais après, c'est quand même un peu ciblé .
Je me doutais un peu grace à l'indice qu'il s'agissait D'ADN, mais alors les passage en ARN + lecture du cordon, dur dur pour ma p'tite tête !
Heureusement que j'avais fait une enigme avec les acides animés pour conclure:D
Sans l'aide patiente d emmaenne, je n'aurais jamais trouvé big_smile
Bon, je ne t'en veux pas c'est quand même une très belle devinette big_smile
Mais: prise de tête  STOP:lol:


A la prochaine ?

 #9 - 23-07-2008 14:39:56

vercingetorix
Sage de Prise2Tete
Enigmes résolues : 46
Messages : 422
Lieu: Boukistan (du sud)

ff. Pap. Saison2 : La cellule de Taupine

Mon dieu, mon dieu, mon dieu!
De la SVT, ça fait au moins..pfiuu...bien un an que j'en ai pas fait et j'me souviens pas de grand chose^^
Enfin, jai quand même réussi à faire le lien entre ta suite de lettre et le codage des acides aminés smile
Si on suppose que BUD est un codon stop, on peut faire comme hypothèse que B=T U=A D=G et H=C
Ensuite on fait plein de jolis triplets, on décode, et on trouve : prise de tete
Bravo à toi collègue, très original comme concept! wink


Aille want to popaul!

 #10 - 23-07-2008 19:33:45

papiauche
Sa Sainteté
Enigmes résolues : 49
Messages : 2123

Aff. Pap. Saisno2 : La cellule de Taupine

Vraiment prise de tête celle-là

On décale d'une lettre: B-->A D-->C etc.

GGT
GCC
TAA
AGC
CTC
CTG
CTT
TGC
CTC
TGA
CTC
ATC

On code les complémentaires

C-->G G-->C T-->A A-->U

CCU
CGG
AUU
UCG
GUG
GAC
GUU
AGC
GAG
ACU
GAG
UAG

On cherche les codons et on trouve

PRISE DE TETE Stop

Merci à Gadjo.


"Je ne lis jamais un livre dont je dois faire la critique. On se laisse tellement influencer." O. Wilde

 #11 - 23-07-2008 20:09:06

minifat
Sage de Prise2Tete
Enigmes résolues : 49
Messages : 902
Lieu: Limoges

aff. pap. saiqon2 : la cellule de taupine

Ah de la SVT. J'ai de la chance j'ai fait ca cette année sinon j'aurais séché longtemps. big_smile


Alors: HHU HDD UBB BHD DUD DUH DUU UHD DUD UHB DUD BUD nous donne en descendant d'une lettre :
GGT GCC TAA AGC CTC CTG CTT TGC CTC TGA CTC ATC

Hop le codage ARN donne:
CCA CGG AUU UCG GAG GAC GAA ACG GAG ACU GAG UAG

Les protéines correspondantes sont:
proline - arginine - isoleucine - sérine - acide glutamique - acide aspartique - acide glutamique - thréonine - acide glutamique - thréonine - acide glutamique - stop

Ce qui donne: PRISEDETETE. smile


Aide toi et le ciel t'aidera!

 #12 - 24-07-2008 03:13:44

ash00
Sage de Prise2Tete
Enigmes résolues : 49
Messages : 5,565E+3

Aff. Pap. Saison2 : La cellulle de Taupine

Cash, suite à sa malheureuse expérience dans la cellule de Cantalène, demanda cette fois à Nopin de l'accompagner pour examiner la cellule de Taupine. Bien lui en a pris, car il pataugea pas mal avec le tableau de conversion.

- Diable, je pige pas! dit Cash à Nopin.
- C'est quoi le problème? lui répondit Nopin qui avait visiblement la tête ailleurs. Etait-ce aux anneaux du mariage qu'il pensait? Tiffany et lui avaient passé de superbes vacances à bronzer et à pratiquer du sport en chambre. Cela l'avait surpris. Il ne pensait plus pouvoir assumer ainsi durant les séances de sport nocturne. Ou alors cela devait être aux anneaux olympiques. En tout cas, Cash venait perturber ses pensées.
- Ben, j'ai bien compris la suite des lettres là... les HHUHDDUB... Cela correspond, après décalage d'une lettre, à une séance d'ADN. Ainsi, on a GGT GCC TAA AGC CTC CTG CTT TGC CTC TGA CTC ATC. Pour pouvoir utiliser son tableau avec les 20 lettres, il faut la séance ARN. Ca aussi, c'est fastoche. J'ai vu comment faire une fois, sur un site d'énigmes, un gars qui posait des questions bizarres et d'autres gens, tout aussi bizarres, qui se creusaient la tête pour y répondre. J'te dis pas quelle perte de temps...
- Ouais ouais, abrège Cash s'te plaît.
- Oui, j'disais que cela donnait en ARN ceci CCA CGG AUU UCG GAG GAC GAA ACG GAG ACU GAG UAG. Mais quand j'essaie de trouver avec le tableau, je m'emberlificote les pinceaux.
- C'est de chez toi, ça, berlificote?
- J'sais pas, c'est c'qu'on dit par chez moi. C'est joli à dire et ça sonne bien!
- Ouais... et bien au lieu de te berlificoter, donne-moi ton PDA et tu vas voir que moi je ne me berlificote pas ou ce qu'tu veux.
- C'est pas comme ça qu'on dit! lui fit remarquer Cash qui en rajoutait une couche supplémentaire.
- Tiens! Voilà, maintenant t'as plus qu'à chercher et ouvrir tes yeux!
- Merci Nopin. C'est vraiment chouette que tu sois revenu. Tu commençais à me manquer... et Tiffany aussi.
- Hum hum! Chasse gardée gamin! Tu vois, dans la vie, il y a deux catégories de femmes. Celles pour moi et celles qui ne sont pas pour toi. Tiffany appartient à ces deux catégories, lui dit Nopin avec un sourire narquois.
- Et mais... c'est pas logique ton truc... hé t'en vas pas! Reviens, on n'a pas fini!... mais l'inspecteur Nopin était déjà parti.
- Il est marrant lui! Pour lui et pas pour moi... ça me laisse qui alors? T'es jaloux parce que je suis plus jeune et plus beau que toi, hein?... lança Cash même s'il savait qu'il parlait tout seul.
- Ouais, bon... Donc ce fameux code... Cela donne... P... R... I... S... E... D... Cash finit de décoder. Merde, ils finissent par m'énerver avec leur prise de tête! Cela devient de l'addiction. Faut qu'ils se fassent soigner les pauvres. Et avec tout ça, j'ai toujours pas pigé le tableau là! Au moins, je ne me suis pas enfermé dans la cellule cette fois. Hé hé, tu deviens une pointure, mon cher Cash!

 #13 - 24-07-2008 10:46:48

zabelle
Amateur de Prise2Tete
Enigmes résolues : 44
Messages : 5

aff. pap. saison2 : la cellume de taupine

Super cette enigme, une bonne PRISE DE TETE!
apres avoir transcrit et traduit sans resultat je crois bien avoir trouvé:

avec un code cesar:
HHUHDDUBBBHDDUDDUHDUUUHDDUDUHBDUDBUD donne
GGTGCCTAAAGCCTCCTGCTTTGCCTCTGACTCATC

ce qui est une suite de 4 bases azotées, un petit bout d'ADN, on reconstitue donc le brin complementaire:

GGT GCC TAA AGC CTC CTG CTT  TGC CTC TGA CTC ATC
CCA CGG ATT TCG GAG GAC GAA ACG GAG ACT GAG TAG

ce qui, traduit en acides aminés (avec le code internationnal entre parentheses)
donne:

CCA CGG ATT TCG GAG GAC GAA ACG GAG ACT GAG TAG
pro   arg   ile   ser   glu   asp   glu   thr   glu    thr  glu   stop
(P)    (R)   (I)   (S)   (E)   (D)   (E)  (T)    (E)   (T)   (E)   stop

vivement la suite!

 #14 - 27-07-2008 21:12:18

Taupine
Sage de Prise2Tete
Enigmes résolues : 49
Messages : 1073

Aff. Pap. SSaison2 : La cellule de Taupine

En décalant la suite de lettres d'un cran, Taupine reconnut une séquence ADN comportant les lettres A, T, C et G. Une étape de transcription lui permit de passer à l'ARN messager. La traduction en une suite d'acides aminés lui donna un peu plus de mal. Heureusement, elle connaissait en revanche le code des acides aminés à une lettre par cœur. C'était donc pour cela que le clavier ne comportait que 20 touches ! Vingt lettres comme les vingts acides aminés !

Taupine tapa le code sur le clavier de la porte blindée et s'empressa de rejoindre JustineF et Quaramba. D'après leurs précédentes discussions à la cantine avec les garçons, celles-ci devaient encore passer une porte pour les rejoindre...

 

Réponse rapide

Rédige ton message
| | | | Upload | Aide
:) :| :( :D :o ;) :/ :P :lol: :mad: :rolleyes: :cool:
Sécurité

Répondez à la devinette suivante : 

Le père de toto a trois fils : Tim, Tam et ?

Mots clés des moteurs de recherche

Mot clé (occurences)
Taupine (7) — Devinette svt (4) — Pap.dz (4) — C est quoi la taupine (3) — C est une cellule mais pas blinde enigme (3) — Codons (3) — Decodage adn perso (2) — Convertisseur d adn (2) — Gag enigme (2) — Pap (1) — Enigmes et devinettes svt (1) — Faire caca dans la taupine (1) — Decoder adn stop ctt (1) — Escape room solution enferme dans un cachot (1) — Adn a g c (1) — Code acide amine 1 lettre + codon stop x (1) — Jeux taupine (1) — Att cgg atc acides amines (1) — C est une cellule mais pas celle blindee enigme (1) — Adn+enigme+cryptage (1) — Cryptage enigme tableau convertisseur d adn (1) — Berlificoter ses pinceaux (1) — Tableau convertisseur adn (1) — Enigme enferme dans une piece porte blindee code (1) — Tableau des differents acides animees pour la traduction (1) — Saison2 (1) — Adn uag et atc (1) — Pruse2tete cellule (1) — Berlificote (1) — Enigme svt (1) — Enigmes sur l universite des antilles guyane (1) — Svt enigme adn forum (1) — Solution escape room enferme dans un cachot (1) — Enferme dans un cachot escape room (1) — Enigmes en svt (1) — Enigme : ces une cellule qui n est pas blindee (1) — Devinette du clavier qui n avait pa touche e (1) — Enigme c est une cellule mais pas celle blinde (1) — C est une cellule mais pas celle blindee c est une operation (1) — A c g suite logique (1) — Acide amine cgg (1) — Porte blindee cellule (1) — Solution jeu escape enferme dans un cachot (1) — Traduction acides animes (1) — Devinette adn 4 lettres 20 mots svt (1) — Cade cesar adn (1) — Taupine + justinef (1) — Art (1) — Ctt.wikipedia (1) — Olympique (1) — C est une cellule mais pas celle blinde (1) — Aff gag (1) — Enigme avec cellule (1) — Nom mathematique anneaux olympiques (1) — Adn stop ctt (1) — +codage cesar drole (1) — Les vingts acides animes (1) — Acides amines cgg (1) — Code de la cellule (1) — Systeme de codage (1) — C est une cellule mais pas celle blindee (1) — Enigme mathematique anneaux olympique (1) — Coeur fait au clavier (1) — Enigme tordue (1) — Acide aff (1) — Atc devient uag puis arn (1) — Enigme gag (1) — Enigme + enferme dans une cellule (1) — Tableau convertisseur d adn (1) — Porte donne sur la libert? (1) — Devinette de la cellule (1) — Enigme en svt (1) — Codon donnant adn en arn (1) — Adn (1) — Stop la cellule (1) —

Pied de page des forums

P2T basé sur PunBB
Screenshots par Robothumb

© Copyright 2002–2005 Rickard Andersson

Prise2Tete Forum Statistiques Liste des membres Hall of Fame Contact
© Prise2tete - Site d'énigmes et de réflexion.
Un jeu où seules la réflexion, la logique et la déduction permettent de trouver la solution.

Flux RSS de Prise2Tete Forum Jeux & Prise2Tete Test & Prise2Tete Partenariat et Publicité sur Prise2Tete