Enigmes

Forum dédié aux énigmes et à toutes formes de jeux de logique.

Déconnexion

Tu n'es pas identifié sur Prise2tete : s'identifier.

accueil Accueil forum Forum
[+]

 #1 - 01-05-2010 16:30:12

MthS-MlndN
Hors d'u-Sage
Enigmes résolues : 49
Messages : 12,414E+3
Lieu: Rouen

Malandrin, S03 E01 : Cueillez, cueillez votre jeunesse... (+INDICES))

Pour ceux qui ont raté le début :

Episode 0 :
www.prise2tete.fr/upload/MthS-MlndN-malandrin3-ep0.pdf

3

A première vue, l'endroit n'avait rien de particulièrement exaltant. L'arrondissement semblait très classique, ressemblant à la majorité des lieux parisiens : des rues qui sentent l'urine, écrasées sous un air qui sent la pollution et le diesel brûlé, avec, vulgairement plantés au milieu, des immeubles de cinq ou six étages posés comme des briques sur une flaque de mazout.

J'exagère un peu, se dit Malandrin, ça a quand même du chien, par ici. En effet, sous la montagne de préjugés bien provinciaux que Malandrin avait accolés à la capitale, le quartier se laissait très bien regarder. Contrairement aux encravatés des heures de pointe qui se bousculaient aveuglément tels des poissons rouges massés dans un bocal trop petit, les autochtones se laissaient aller à une sorte de nonchalance qui les rendaient naturels… presque humains. Certains se disaient même bonjour. A la décharge de ces aborigènes apparemment insoucieux, une ou deux rues pavées, filant droit entre des bâtisses datant visiblement de deux à trois siècles, semblaient plus inviter à la déambulation sifflotante qu'à la marche au pas.

Quant à la femme qui accueillit Malandrin devant l'imposant immeuble victorien, sa bouche semblait plus faite pour les baisers que pour les ordres. Et ces yeux…, pensait Malandrin avec un pincement au coeur très perceptible, mon Dieu, deux pures émeraudes… je pourrais m'agenouiller devant une beauté mille fois plus fade. Elle le regarda brièvement passer, s'attendant visiblement à quelqu'un qui aurait une autre allure. Les cheveux longs et la longue veste en cuir ne lui donnaient apparemment pas l'air d'un inspecteur de police, alors il s'approcha et sourit.

"Vous êtes Mademoiselle Hoche, la conseillère principale de l'institut Robert Kock ? (Elle opina, l'air surpris.) Inspecteur Malandrin.
- Ah ! bonjour inspecteur, répondit la jeune femme dans un sourire qui cloua Malandrin sur place, bien qu'y pointât un semblant d'inquiétude très compréhensible. Dépêchons-nous de rentrer, ce qui arrive n'est pas bon pour la réputation de notre école."

Le prenant par le bras, elle le tira avec douceur vers l'intérieur de la bâtisse et claqua la porte derrière eux.

"La jeune fille qui a trouvé le corps est un peu… chamboulée… je lui ai dit que personne ne la dérangerait avant ce soir. Si possible même, je pense que… enfin… (La jeune femme rougissait à moitié.) Je pensais qu'il serait bon de la laisser tranquille aujourd'hui, non ? Je ne veux pas faire votre métier à votre place, mais… elle avait l'air vraiment…
- Pas de problème, coupa doucement Malandrin. Je vais la laisser respirer, la pauvre. Elle doit être très secouée. (Par réflexe professionnel, il continua.) Généralement, les indices les plus importants sont sur le lieu du crime, alors pas la peine de la déranger tout de suite. (Se disant que cette dernière phrase paraîtrait très froide par rapport aux précédentes, il se reprit.) Ce n'est jamais évident de voir ce genre de choses, surtout à un si jeune âge.
- Oui, opina Mlle Hoche d'une voix teintée d'émotivité mal dissimulée. Dix-huit ans tout juste… je n'arrive pas à imaginer ce que ça a pu lui faire ressentir."

Elle redressa la tête, se força à sourire, et salua deux superbes jeunes femmes (dix-huit, dix-neuf ans ? deux blondes, l'une un peu rondelette, l'autre au profil aquilin, toutes deux dotées d'yeux d'un bleu cristallin).

"Bonjour, mesdemoiselles ! Vous avez bien lu le tableau d'informations ? Le cours de Madame Piaffe est reporté à la semaine prochaine.
- Oui, mademoiselle Hoche, gazouilla l'une des deux, on a vu, merci beaucoup !
- Bon après-midi !" répondit l'autre d'une voix un peu plus grave, pleine de confiance, presque… érotique.

Pour des raisons de respectabilité, Malandrin se retint de se retourner pour contempler les deux naïades, tandis qu'elles gagnaient le hall d'entrée du bâtiment avec un déhanché dévastateur.



4

Une cloche tinta quelques fois, annonçant dix heures et le début du deuxième cours de la matinée (élèves de première année : fonctionnement du coeur humain avec le Docteur Martin ; deuxième année : épidémiologie avec Madame le Docteur Lartigue ; troisième année… le nom de la matière était incompréhensible au faible niveau de connaissances de Malandrin, qui cessa là sa lecture). Dominique Porta, l'inspecteur de la criminelle envoyé le rejoindre, venait d'arriver sur les lieux, dix minutes après Malandrin. Mlle Hoche les fit entrer dans une grande pièce carrelée, ornée de trois WC et d'autant de lavabos, disposés devant un immense miroir. Les deux jeunes pompiers, premiers appelés sur les lieux, quittèrent la salle exiguë en les saluant. Mlle Hoche ferma soigneusement la porte derrière eux.

A terre gisait le corps de Cindy Carlot, vingt ans, splendide brune à la taille élancée, dont la courte jupe blanche laissait dépasser des jambes fines et graciles, dont la poitrine aurait été d'une délicieuse provocation si elle n'avait pas eu, pile entre ses deux seins ronds, la lame d'un couteau de cuisine, enfoncée presque jusqu'au manche. Elle était sur le dos, les jambes serrées, alignées avec son corps, et les bras à la perpendiculaire, dans une position christique. Le tueur a dû forcer comme un âne pour rentrer la lame ici, se dit Malandrin. Ce n'est pas cette blessure qui l'a tuée. Elle est juste là pour l'image. Elle fait partie de la mise en scène. Et, immédiatement après : On ne trouvera pas d'empreintes sur la lame. Les contusions visibles sur ses jambes sont sans nul doute post-mortem. Puis, encore : Il faudrait déterminer par où elle a été amenée jusqu'ici, et ce qui l'a tuée… sans doute un poison.

"Avez-vous touché à quelque chose ? demanda Malandrin à Mlle Hoche, volant à l'inspecteur Porta ce qui aurait dû être sa première réplique.
- Non, rien du tout, répondit-elle, mal à l'aise. (La façon dont elle évitait le corps des yeux, et le semblant de nausée qui perçait dans sa voix, semblait corroborer ses dires.) Apparemment, Carla, euh…
- Qui est Carla ?
- La jeune femme qui a découvert le corps. Elle m'a raconté qu'elle l'avait saisi, secoué, qu'elle avait donné quelques gifles, en espérant la réveiller… (Un sanglot, discret mais perceptible, écorcha ce dernier mot.)
- Pas de problème, Mademoiselle, fit Porta. Vous pouvez sortir si vous le souhaitez. Nous refermerons à clé derrière nous et nous viendrons à votre bureau."

Mlle Hoche opina, et sortit de la pièce sans demander son reste. Après avoir échangé ses premières impressions avec l'inspecteur de la criminelle, il enfila une paire de gants en latex et, tandis que Porta se livrait aux premiers prélèvements, il fouilla méthodiquement les affaires de la jeune femme. Diverses paperasses en ressortirent, dont une courte note manuscrite qui l'inspira directement.

Laissant l'autre inspecteur à ses petites affaires, il sortit de la salle de toilette, s'appuya sur le mur extérieur et regarda passer quelques étudiantes. Difficile d'enquêter sur un meurtre sans se laisser déconcentrer par la beauté qui irradiait de ces jeunes femmes. Pas toutes, certes, mais parmi les quelques-unes qui passèrent devant lui, deux faillirent le faire tomber à la renverse. Il était affolé par leurs courbes généreuses, et là où les "deuxièmes cerveaux" de certains n'auraient hurlé que des insanités à leur direction, ses hormones faisaient ménage avec son émotionnel un peu niais pour former un cocktail perturbant et enivrant.

Une grande inspiration, une grande expiration, et il fit sauter temporairement le fusible de ses pulsions romantico-sexuelles pour contempler, carnet de notes à la main, le petit papier manuscrit qu'il avait trouvé, plié en quatre, dans la poche droite du chemisier de feu Mademoiselle Cindy Carlot :

http://www.prise2tete.fr/upload/MthS-MlndN-malandrin3-ep1-papier.jpg

Malandrin aurait parié qu'aucune de ces quatre filles n'existait. Leurs initiales, en revanche, ainsi que leurs fins en "-ine", étaient plus qu'évocatrices. Il disposa proprement les quatre suites de 1 et de 0, bien alignées, colonne après colonne, précédées des initiales des prénoms. Il en déduisit une liste de lettres qu'il put transcrire/traduire "de mémoire" (et à l'aide de Google, qu'il consultait depuis l'iPhone que le commissariat lui fournissait) en un message visiblement crypté, lui aussi. Un code vieux comme le monde, ou presque : un, deux, trois, Malandrin remonta finalement au message originel.

Deux mots, qui ne lui apportaient rien du tout. Mais alors, vraiment rien. Un message flou, qui ne faisait que le mettre exactement face à ce qu'il cherchait. Comme si ses recherches l'avaient seulement remis face à leur cible…

L'inspecteur Porta sortit de la salle de toilette, se dirigeant vers une entrée dérobée où des hommes attendaient son feu vert pour emballer le corps et l'emporter avec eux. Il connaissait déjà assez Malandrin, ayant travaillé avec lui sur une dizaine de meurtres, pour savoir que sa sortie de la salle était en soi une preuve qu'il ne voulait plus examiner le corps.

Malandrin verrouilla la porte. Confus, il se dirigeait vers le bureau de Mlle Hoche lorsqu'une illumination lui vint. Pas celui de Cindy, non… celui de… Ses cours d'histoire, si loin fussent-ils, lui avaient au moins laissé ce souvenir-là. Il avait un nom ; peut-être un pseudonyme de quelqu'un que Cindy connaissait ? ou une comparaison qui devait, de près ou de loin, évoquer quelqu'un qu'elle avait rencontré ? Il faudrait interroger quelques amies de feu Cindy, recouper cet indice avec d'autres… mais la première piste était là. Six petites lettres qui donneraient peut-être à Malandrin deux jours d'avance sur les résultats d'analyses de la crim'.






NB : ben oui, je suis de plus en plus verbeux... Désolé roll
NB2 : ma boîte à MP est grande ouverte smile



Annonces sponsorisées :

 
Réponse :

Podcasts Modern Zeuhl : http://radio-r2r.fr/?p=298
  • |
  • Répondre

#0 Pub

 #2 - 01-05-2010 16:51:05

papyricko
Expert de Prise2Tete
Enigmes résolues : 48
Messages : 669
Lieu: Sur le plateau

malandrin, s03 e01 : cueillez, cueillez votre jeunessr... (+indices)

Bonjour....
Allez au boulot c'est la fête du travail non?

Adeline  A    Adénine
Caroline     C    Cytosine
Géraldine   G    Guanine
Titine         T     Thymine
 
   
Il faut maintenant trouver le complément des suites 001000 ect... A voir

En mettant les suites en colonnes il n'apparait qu'un seul 1 par colonne...

CATGCTGTTCTGCAGCAACTACACCATGACGTC

Un vieux code un deux trois César?
Non cela ne donne rien.

Pas plus de succès avec le brin complémentaire:
GTACGACAAGACGTCGTTGATGTGGTACTGCAG.....

http://upload.wikimedia.org/wikipedia/commons/8/81/ADN_animation.gif

Je vais avoir besoin de ma copine...
http://2e.img.v4.skyrock.net/2e0/chihiro81/pics/827194807_small.jpg

Mémoire... Reste à voir l'ARN messager....

Je reprends:
CATGCTGTTCTGCAGCAACTACACCATGACGTC

L' ARN correspondant
GUA CGA CAA GAC GUC GUU GAU GUG GUA CUG CAG
découpé en série de 3 nucléotides devrait permettre de trouver 11 acides aminés.
V R Q D V V D V V L Q
passé au vieux code 1 2 3  César donne
SON ASSASSIN......

Je cogite pour la suite
Cogito ergo sum...
Non du grec plutôt: και συ τεκνον  ou en latin Tu quoque, mi fili
Parmi les assassins de César un certain BRUTUS....
Mais la suite nous le dira...

 #3 - 01-05-2010 17:03:19

Arrakis
Elite de Prise2Tete
Enigmes résolues : 49
Messages : 1149
Lieu: Dark side of the moon

Malandrin, 03 E01 : Cueillez, cueillez votre jeunesse... (+INDICES)

Hello smile

Premières pensées et constatations en vrac après lecture:

1. Les lettres ACGT font de suite penser à l'ADN

2. Chaque série binaire comporte 33 éléments

3. Le binaire lu en colonnes donne uniquement les valeurs décimales 1 2 4 et 8 (A B D et H)

4. Il y a une fois le 1 par ligne (8A  11C  6G  8T)

Edit:

En prenant la lettre correspondant au 1 dans chaque ligne, j'obtiens le brin d'adn suivant:

CATGCTGTTCTGCAGCAACTACACCATGACGTC

qui me donne ce brin d'arn, divisé par 3 pour obtenir des codons:

GUA CGA CAA GAC GUC GUU GAU GUG GUA CUG CAG

En prenant la lettre associée à chaque codon, j'obtiens:

VRQDVVDVVLQ

qui avec un code césar 3 me donne:

SON ASSASSIN

Pure spéculation, mais comme elle a été retrouvée dans une position christique, elle a peut-être pris elle-même cette position avant de mourir, et ce serait donc l'assassin du christ:

PILATE

hmmhmmhmmhmmhmmhmmhmmhmmhmmhmmhmmhmm (on sent que je suis perplexe, là?)hmmhmmhmmhmmhmmhmmhmmhmm

Edit:

Bon... j'ai une meilleure idée...

On utilise le code César pour le message, donc, c'est peut-être l'assassin de César, à savoir BRUTUS, qui fait aussi 6 lettres...


www.enigmes.ch

 #4 - 01-05-2010 17:03:05

emmaenne
Elite de Prise2Tete
Enigmes résolues : 49
Messages : 3058
Lieu: Au sud du Nord

Malandrni, S03 E01 : Cueillez, cueillez votre jeunesse... (+INDICES)

J'ai vraiment beaucoup de mal à lire quand c'est aussi long, désolé smile

Code:

  ACGTACGTACGTACGTACGTACGTACGTACGTA
  CGTACGTACGTACGTACGTACGTACGTACGTAC
  GTACGTACGTACGTACGTACGTACGTACGTACG
  TACGTACGTACGTACGTACGTACGTACGTACGT
A 010000000000010011001010010010000
C 100010000100100100100101100001001
G 000100100001001000000000000100100
T 001001011010000000010000001000010
  CATGCTGTTCTGCAGCAACTACACCATGACGTC

CATGCTGTTCTGCAGCAACTACACCATGACGTC
GUACGACAAGACGUCGUUGAUGUGGUACUGCAG

VRQDVVDVVLQ (avec les protéines des acides aminés)

SON ASSASSIN avec le code César

serait-ce Brutus ? mais pourquoi donc?


Dans le cadre de la quinzaine du beau langage, ne disez pas disez, disez dites. (Julos Beaucarne)

 #5 - 01-05-2010 18:29:51

MthS-MlndN
Hors d'u-Sage
Enigmes résolues : 49
Messages : 12,414E+3
Lieu: Rouen

Maladnrin, S03 E01 : Cueillez, cueillez votre jeunesse... (+INDICES)

@papyricko : merci pour l'image... qu'est-ce que cette femme est belle (*_*)'


Podcasts Modern Zeuhl : http://radio-r2r.fr/?p=298

 #6 - 01-05-2010 18:43:13

sosoy
Elite de Prise2Tete
Enigmes résolues : 49
Messages : 2365
Lieu: un peu d'ici... bcp d'ailleurs

Malandrin, S03 E01 : Cueillez, cueillze votre jeunesse... (+INDICES)

oui je sais, je sais coolbig_smile

Bon, où ai-je mis ces notes .... sifflote ....  lol

Ayééééé, j'ai tout lu ... c'est vraiment bien écrit smile
Je vais demander de l'aide à Cunégonde pour trouver ... elle lâchera comme ça un peu le pauvre Manix big_smile


choueèèète, du binaire ! big_smile

Adeline 2148111504 udh... ouais bof, je fais fausse route là ...
non, colonne par colonne, donc 0100 1000 0001 0010 0100 0001 0010 0001 0001 0100 0001 .... 4 8 1 2 4 1 2 1 1 4 1 DHABDABAADA.. ouais non plus hmm

bien que ce doit être crypté et ACGT .... l'ADN ... à creuser ... Adénine-Thymine. Cytosine-Guanine.
et une petite voix me dit que dans mes colonnes un truc bizarre se produit ... 0100 1000 0001 0010 0100 0001 0010 0001 0001 0100 0001 ... il n'y a chaque fois qu'un seul 1 big_smile

je reprends donc mes notes

Code:

A 010000000000010011001010010010000

C 100010000100100100100101100001001

G 000100100001001000000000000100100

T 001001011010000000010000001000010

et

Code:

CATGCTGTTCTGCAGCAACTACACCATGACGTC

et donc

GUACGACAAGACGUCGUUGAUGUGGUACUGCAG ...

par trois = Valine, Arigine.... etc bref VRQNVVNVVLQ

et je comprends toujours pas tes indices, même en essayant césar, en décalage un puis deuxpuis trois hmm


Si j'étais payée à chaque connerie que je dis, je serais milliardaire.

 #7 - 01-05-2010 18:48:21

celina58
Expert de Prise2Tete
Enigmes résolues : 49
Messages : 566

Malandrin, S03 E01 : Cueilllez, cueillez votre jeunesse... (+INDICES)

A  0 1 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 1 0 0 1 0 1 0 0 1 0 0 1 0 0 0 0

C  1 0 0 0 1 0 0 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 1 1 0 0 0 0 1 0 0 1

G  0 0 0 1 0 0 1 0 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 0

T  0 0 1 0 0 1 0 1 1 0 1 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 1 0 0 0 0 1 0

    4 8 1 2 4 1 2 1 1 4 1 2 4 8 2 4 8 8 4 1 8 4 8 4 4 8 1 2 8 4 2 1 4

    d h a b d a b a a d a b d h b d h h d a h d h d d  h a b h d b a d

Mathias m'indique que je ne dois pas traduire du binaire

   oups je dois certainement lire en colonne



A    T       G     C
                         1
1     
        1
                1
                          1
        1
                1
        1   
        1
                            1
        1     
                1   
                            1
1   
                1
                            1
1
1
                            1
       1
1
                            1
1
                            1
                            1
1
      1
               1
1
                            1
               1
      1
                             1

Ce qui me donne


    GTA CGA CAA GAC GTC GTT GAT GTG GTA CTG CAG
   CAT GCT GTT CTG CAG CAA CTA CAC CAT GAC GTC

     GUA CGA CAA GAC GUC GUU GAU GUG GUA CUG CAG
       v     arg    ?   asp    v      v    asp    v      v       l     ?

Et voilà, j'abandonne car je ne suis vraiment pas douée.

Et un petit mp encourageant m'incite à continuer.

Alors, je cherche..................le code vieux comme le monde       

César,  le chiffre Porta   ... ?

Alors j'avance dans mes recherches et je trouve :

     GUA CGA CAA GAC GUC GUU GAU GUG GUA CUG CAG
       v     arg   gln   asp    v      v    asp    v      v       l  gln
       
       V      R     Q     D      V     V     D     V      V      L     Q

déchiffré avec le code César     décalage de 3 suivant l'indice de Malandrin

je trouve   SONAS SASSI N   que je lis   SON ASSASSIN

J'ai peut-être trouvé un indice      sans doute un poison

ou alors 

Le Docteur Lartigue   anagramme de    ligature = lien qui aurait pu laisser des contusions aux jambes

L'assassin est une    énigme

Ou peut-être tout simplement   Cindy Carlot elle même

Elle s'est suicidée

 #8 - 01-05-2010 19:52:31

eglantine52
Expert de Prise2Tete
Enigmes résolues : 49
Messages : 641

malandrin, s03 e01 : cieillez, cueillez votre jeunesse... (+indices)

Ca va Mathias? Tu as avalé une encyclopédie ce midi pour nous pondre un si long texte ?

Bon, je commence :

ACGT
0100
1000
0001
0010
0100
0001
0010
0001
0001
0100
0001
0010
0100
1000
0010
0100
1000
1000
0100
0001
1000
0100
1000
0100
0100
1000
0001
0010
1000
0100
0010
0001
0100    =

ACGT

ACGT représente les quatre bases de nucléique-acide qui composent ADN. A représente Adénine et paires avec T, lequel représente Thymine. Le C représente Cytosine et paires avec le G, Guanine. Ces quatre nucléiques acides composez le code génétique d'une créature, ou ADN.

Mon 1er résultat : CATGCTGTTCTGCAGCAACTACACCATGACGTC
                          GTACCACAAGACGTCGTTGATGTGGTACTGCAG
                          CAUGCUGUUCUGCAGCAACUACACCAUGACGUC
1 . CAU = HISTIDINE   H
2 . GCU = ALANINE     A
3 . GUU = VALINE       V
4 . CUG = LEUCINE     L
5 . CAG = GLUTAMINE Q
6 . CAA =  HISTIDINE  H
7 . CUA = LEUCINE     L
8 . CAC = HISTIDINE  H
9 . CAU = HISTIDINE  H
10. GAC = ACIDE ASPARTIQUE  D
11. GUC = VALINE      V

Après 2 mp, voila que tu m'informes que je me complique la vie !
Je recommence :


CAT  GCT GTT  CTG CAG CAA CTA CAC CAT GAC GTC
GUA CGA CAA GAC GUC GUU GAU GUG GUA CUG CAG
  V      R     Q      D     V      V     D     V     V     L      Q   

donc avec César 3, je trouve :    SON ASSASSIN


Chaque coup de colère est un coup de vieux, chaque sourire est un coup de jeune!

 #9 - 01-05-2010 22:28:56

Flying_pyros
Sage de Prise2Tete
Enigmes résolues : 48
Messages : 3414
Lieu: Près de la mer

malandrin, s03 e01 : cueillea, cueillez votre jeunesse... (+indices)

Apparemment, toi aussi t'aimes bien les tartines !!! lol
Bon, je vais essayer de faire plus court big_smile :
Tout d'abord, j'espère que notre victime n'est pas cette Cindy big_smile
http://www.amazing-programs .com/img/CindyCrawford45.jpg

Tout comme notre inspecteur, j'aligne mes petites colonnes :

Code:

A 0 1 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 1 0 0 1 0 1 0 0 1 0 0 1 0 0 0 0
C 1 0 0 0 1 0 0 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 1 1 0 0 0 0 1 0 0 1
G 0 0 0 1 0 0 1 0 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 0
T 0 0 1 0 0 1 0 1 1 0 1 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 1 0 0 0 0 1 0

Ce qui me donne la suite :
CAT GCT GTT CTG CAG CAA CTA CAC CAT GAC GTC
Je transcris :
GTA CGA CAA GAC GTC GTT GAT GTG GTA CTG CAG
Je traduis :
GUA CGA CAA GAC GUC GUU GAU GUG GUA CUG CAG
Ce qui nous donne les lettres :
V R Q D V V D V V L Q
Qui par un petit coup de César permet de voir : SON ASSASSIN

Bon OK, on ne parle pas de l'assassin de Cindy mais de qui alors ?
Un mp, plus tard, je comprend que l'on parle de ce brave César assassiné en 44 par son fils Brutus. wink

 #10 - 02-05-2010 18:43:29

MthS-MlndN
Hors d'u-Sage
Enigmes résolues : 49
Messages : 12,414E+3
Lieu: Rouen

mzlandrin, s03 e01 : cueillez, cueillez votre jeunesse... (+indices)

papyricko est déjà parvenu au bout, jusqu'à ces six lettres magiques qui sont la réponse de cette première étape...

Flying y est presque (il s'est arrêté après le décodage entier, à 30 secondes de la fin lol)

Ma boîte à MPs est ouverte pour cette étape qui a l'air franchement difficile... Je répondrai régulièrement à mes messages, et je vous laisse une semaine. Sympa, non ? smile


Podcasts Modern Zeuhl : http://radio-r2r.fr/?p=298

 #11 - 02-05-2010 20:50:35

langelotdulac
Ange de Prise2Tete
Enigmes résolues : 49
Messages : 2963
Lieu: Paradis

Malandrin, S03 E01 : Cueillez, cueillez votre jeunesse... (+NIDICES)

Les initiales des 4 prénoms me font penser à l'Adénine, la Cytosine, la Guanine et la Thymine, les quatre bases qui composent l'ADN;
Je suis les instructions et j'aligne (bien), les chiffres sous les initiales :

A C G T
0 1 0 0 = C
1 0 0 0 = A
0 0 0 1 = T
0 0 1 0 = G
0 1 0 0 = C
0  0 0 1 = T
0 0 1 0 = G
0 0 0 1 = T
0 0 0 1 = T
0 1 0 0 = C
0 0 0 1 = T
0 0 1 0 = G
0 1 0 0 = C
1 0 0 0 = A
0 0 1 0 = G
0 1 0 0 = C
1 0 0 0 = A
1 0 0 0 = A
0 1 0 0 = C
0 0 0 1 = T
1 0 0 0 = A
0 1 0 0 = C
1 0 0 0 = A
0 1 0 0 = C
0 1 0 0 = C
1 0 0 0 = A
0 0 0 1 = T
0 0 1 0 = G
1 0 0 0 = A
0 1 0 0 = C
0 0 1 0 = G
0 0 0 1 = T
0 1 0 0 = C
Ce qui me donne une séquence ADN big_smile
Je transcris en ARN : GUACGACAAGACGUCGUUGAUGUGGUACUCCAG
Ce qui me donne 11 acides aminés : Valine, Arginine, Glutamine, acide Aspartique, Valine, Valine, acide Aspartique, Valine, Valine, Leucine, Glutamine = V R Q D V V D V V L Q
Qu'il me faut décrypter avec un code César ( vieux comme le monde..) progressif (un, deux, trois ).
Une bonne nuit de sommeil et un mp plus tard ....je trouve  : son assassin
Bon sang mais c'est bien sûr !
"tu quoque mi fili" = Brutus big_smile


Tu es largement assez dingo pour qu'un Minito te semble cohérent \o/ !

 #12 - 02-05-2010 21:42:45

HAMEL
Elite de Prise2Tete
Enigmes résolues : 49
Messages : 2405
Lieu: Paris

malandrin, s03 e01 : cueilkez, cueillez votre jeunesse... (+indices)

Mathias a écrit:

L'arrondissement semblait très classique, ressemblant à la majorité des lieux parisiens : des rues qui sentent l'urine

Je le savais bien que Mathias avait écumé tous les endroits glauques à Paris la veille de la chasse au trésor lol

Revenons à nos moutons.

Grâce à ma copine So, je comprends qu'il s'agit de génétique.
l' A C G T je pensais plutôt à lui

http://www.rfi.fr/actufr/images/062/cgt_thibault220.jpg
lol

Bon, je trouve mon premier bloc de lettres

CAT GCT GTT CTG CAG CAA CTA CAC CAT GAC GTC

dé -CODONS tout cela et donnons à chaque acide aminé sa lettre

HAVLQQLHHDVQ

Un coup de césar, ce bon vieux décodeur

EXSINNIEEAS

euh... ça doit pas être ça.

Un post du génial auteur me remet dans le drot chemin, il fallait transcrire:

GUA CGA CAA GAC GUC GUU GAU GUG GUA CUG CAG

re-dé CODONS

VRQDVVDVVLQ


Un dernier coup d'César

SON ASSASSIN

Ca commence à ressembler à quelque chose, mais je ne vois pas comment exploiter cela.

En tout cas, pour son texte, ses idées brillantes et ses codages , à mathias je dis
http://img512.imageshack.us/img512/5999/applaudissement.gif


-C'est curieux chez les marins ce besoin de faire des phrases !

 #13 - 02-05-2010 21:45:16

piode
Cacografe de Prise2Tete
Enigmes résolues : 28
Messages : 1680
Lieu: Sur le dos d'une autruche

malandrin, s03 e01 : cueillez, cueillez votre jeuneqse... (+indices)

Mathias : j'aime te lire ! big_smile mais je me sent pas de faire un énigme ce soir sad trop fatigué !


"Être une enzyme avec fonction hydrolyse, mais ne pas savoir comment si prendre ..."

 #14 - 03-05-2010 13:00:29

ash00
Sage de Prise2Tete
Enigmes résolues : 49
Messages : 5,569E+3

Malandrin, S03 E01 : Cueillez, cueillez vvotre jeunesse... (+INDICES)

Juste pour faire croire que j'ai trouvé!

Je n'ai pas encore lu, pas le temps... Mais je te jure que je vais me faire un plaisir en lisant ton histoire et en décodant tous tes trucs... avec des nichons! lol

EDIT:

Voilà j'ai lu... faut-il dire que j'aime toujours autant?... Que dis-je... j'adore... et ça m'fait mal de le dire à mon meilleur ennemi de P2T wink
Juste un truc moche: que Malandrin arrête de réfléchir à voix haute, cela gâche le plaisir de trouver quoi faire! (mais comme je connais, cela m'a pris 10 minutes grand maximum... si j'avais su, je m'y serais mis plus tôt)
Mais aussi qu'il aille au bout de ses fantasmes, que diable!


Code:

C --> G --> G
A --> T --> U
T --> A --> A
G --> C --> G

CAT    GTA    GUA    V
GCT    CGA    CGA    R
GTT    CAA    CAA    Q
CTG    GAC    GAC    D
CAG    GTC    GUC    V
CAA    GTT    GUU    V
CTA    GAT    GAU    D
CAC    GTG    GUG    V
CAT    GTA    GUA    V
GAC    CTG    CUG    L
GTC    CAG    CAG    Q

vrqdvvdvvlq (avec un décalage César) --> son assassin

--> assassin de César = Brutus!

Y a pas à dire, il a une sale tête! Vas-y mon Popeye Malandrin, fous-lui la pâtée et cajole les jolies minous lol
http://www.popeyefreshfoods.com/images/brutus.gif

 #15 - 03-05-2010 15:03:53

FRiZMOUT
Verbicruciste binairien
Enigmes résolues : 49
Messages : 2210

Maandrin, S03 E01 : Cueillez, cueillez votre jeunesse... (+INDICES)

Épisode 1 pas trop difficile puisqu'il suffit de suivre les indications/réflexions de ce cher Malandrin.

On comprend vite que le prénom de chacune des filles (Adeline, Caroline, Géraldine et Titine) correspond en fait à un nucléotide (respectivement Adénine, Cytosine, Guanine et Thymine).

En reprenant les séries binaires, on obtient :

Code:

A : 010000000000010011001010010010000
C : 100010000100100100100101100001001
G : 000100100001001000000000000100100
T : 001001011010000000010000001000010
    ↓↓↓↓↓↓↓↓↓↓↓↓↓↓↓↓↓↓↓↓↓↓↓↓↓↓↓↓↓↓↓↓↓
    CATGCTGTTCTGCAGCAACTACACCATGACGTC

En transcrivant cette "séquence d'ADN" en ARN, puis en traduisant l'ARNm en acides aminés, on obtient :

Code:

CAT → GUA → Valine    → V 
GCT → CGA → Arginine  → R
GTT → CAA → Glutamine → Q
CTG → GAC → Aspartate → D
CAG → GUC → Valine    → V
CAA → GUU → Valine    → V
CTA → GAU → Aspartate → D
CAC → GUG → Valine    → V
CAT → GUA → Valine    → V
GAC → CUG → Leucine   → L
GTC → CAG → Glutamine → Q

VRQDVVDVVLQ donne SONASSASSIN grâce au chiffre de César avec un décalage de 3.


"Son assassin" ? Le meurtrier de Cindy a peut-être le même nom que celui de César :


BRUTUS !


_____

Excellent début, même s'il n'y a rien de bien compliqué !

J'avoue que la longueur du texte m'a un peu rebuté à commencer l'énigme mais finalement le discours n'a rien d'un verbiage et met véritablement dans l'ambiance. J'attends la suite avec grande impatience.

Bravo Mathias, tu es sublîme. XD

 #16 - 03-05-2010 15:05:25

MthS-MlndN
Hors d'u-Sage
Enigmes résolues : 49
Messages : 12,414E+3
Lieu: Rouen

Malandrin, S03 E01 : Cueillez, cueillez votre jeunessse... (+INDICES)

FRiZMOUT a écrit:

Épisode 1 pas trop difficile puisqu'il suffit de suivre les indications/réflexions de ce cher Malandrin.

Allez, les autres ! Plus qu'à lol


Podcasts Modern Zeuhl : http://radio-r2r.fr/?p=298

 #17 - 03-05-2010 21:32:59

moicestmoi
Elite de Prise2Tete
Enigmes résolues : 48
Messages : 1617
Lieu: Avec vous :-)

Malandrin, S03 E01 : Cueeillez, cueillez votre jeunesse... (+INDICES)

J'ai tout lu : c'est superbement présenté smile

Par contre, pas moyen de comprendre comment comment décrypter ton premier code.
Il faut trouver un prénom de 6 lettres !
En lien avec le titre, j'aurai pensé soit à Aude, soit à Cassandre mais bien entendu, ça ne fait pas 6 lettres.
http://lyc-paul-bert.scola.ac-paris.fr/college/Projets/sixieme/Poesie_6.1/medias/APlacerCassandre.jpg

Autre piste : les initiales des prénoms : ACTG, soit mais il me manque qq chose. Je te cite : Malandrin aurait parié qu'aucune de ces quatre filles n'existait. Leurs initiales, en revanche, ainsi que leurs fins en "-ine", étaient plus qu'évocatrices. Il disposa proprement les quatre suites de 1 et de 0, bien alignées, colonne après colonne, précédées des initiales des prénoms. Il en déduisit une liste de lettres qu'il put transcrire/traduire "de mémoire" (et à l'aide de Google, qu'il consultait depuis l'iPhone que le commissariat lui fournissait) en un message visiblement crypté, lui aussi. Un code vieux comme le monde, ou presque : un, deux, trois, Malandrin remonta finalement au message originel.

0 1 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 1 0 0 1 0 1 0 0 1 0 0 1 0 0 0 0
1 0 0 0 1 0 0 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 1 1 0 0 0 0 1 0 0 1
0 0 0 1 0 0 1 0 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 0
0 0 1 0 0 1 0 1 1 0 1 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 1 0 0 0 0 1 0

donc on a
A 0100
C 1000
T 0001
G 0010
A 0100
C 0001
T 0010
G 0001
A 0001
C 0100
T 0001
G 0010
A 0100
C 1000
T 0010
G 0100
A 1000
C 1000
T 0100
G 0001
A 1000
C 0100
T 1000
G 0100
A 0100
C 1000
T 0001
G 0010
A 1000
C 0100
T 0010
G 0001
A 0100
sympa comme tout big_smile
Et maintenant, je poursuis mes recherches...


L'angle droit bout à 90 degrés.

 #18 - 05-05-2010 15:26:21

ravachol
Elite de Prise2Tete
Enigmes résolues : 49
Messages : 1278
Lieu: La vieille ouvrière de F.Bobin

Malandrin, S03 E01 : Cueillez, cueillez votre jeunesse... ((+INDICES)

Salut,

Les 4 prénoms me conduisent aux 4 bases azotées que sont L'adénine, la cytosine la guanine et  la thymine:

Code:

A 010 000 000 000 010 011 001 010 010 010 000
C 100 010 000 100 100 100 100 101 100 001 001
G 000 100 100 001 001 000 000 000 000 100 100
T 001 001 011 010 000 000 010 000 001 000 010

La transcription et la translation du gène à la protéine donnent:


Code:

CAT GCT GTT CTG CAG CAA CTA CAC CAT GAC GTC
GUA CGA CAA GAC GUC GUU GAU GUG GUA CUG CAG
VAL ARG GLN ASP VAL VAL ASP VAL VAL LEU GLN

Soit les lettres V R Q D V V D V V L Q, dont je ne sais vraiment pas quoi faire lol lol

Je jette l'éponge.
Je me débrouillerai peut-être mieux par la suite.
En attendant, bravo pour cette intrigue palpitante.
smile

 #19 - 06-05-2010 09:57:10

Gadjo
Déconoclaste
Enigmes résolues : 47
Messages : 1619
Lieu: Dans ma roulotte

Malandrin, S03 E01 : Cueillez, cueillez votre jeunesse... (+INDICCES)

Hum pas certain que Camille va apprécier cette enquête !lol

Bon j'en suis là:

Code:

U    0    U    0    0    0    0    0    0    0    0    0    0    0    U    0    0    U    U    0    0    U    0    U    0    0    U    0    0    U    0    0    0    0
G    G    0    0    0    G    0    0    0    0    G    0    0    G    0    0    G    0    0    G    0    0    G    0    G    G    0    0    0    0    G    0    0    G
C    0    0    0    C    0    0    C    0    0    0    0    C    0    0    C    0    0    0    0    0    0    0    0    0    0    0    0    C    0    0    C    0    0
A    0    0    A    0    0    A    0    A    A    0    A    0    0    0    0    0    0    0    0    A    0    0    0    0    0    0    A    0    0    0    0    A    0
                                                                                                                                    
    G    U    A    C    G    A    C    A    A    G    A    C    G    U    C    G    U    U    G    A    U    G    U    G    G    U    A    C    U    G    C    A    G
        V              R              Q             D             V             V             D             V            V              L             Q

Ce qui me donne gtace à César:
Son assassin.
Après, je me gratte la tête.sad
L'assassin de Cesar ? Brutus ?
Une enquête qui s'annonce bien palpitante!
Merci et bravo big_smile


http://img25.imageshack.us/img25/8135/applaudissements.gif


A la prochaine ?

 #20 - 06-05-2010 22:17:45

gelule
Expert de Prise2Tete
Enigmes résolues : 48
Messages : 778

Malandrin ,S03 E01 : Cueillez, cueillez votre jeunesse... (+INDICES)

le code génétique et le code de césar nous donnent :
SON ASSASSIN
pour rester dans la logique du message Malandrin a certainement pensé à BRUTUS

 #21 - 08-05-2010 10:50:35

MthS-MlndN
Hors d'u-Sage
Enigmes résolues : 49
Messages : 12,414E+3
Lieu: Rouen

malandrin, s03 e01 : cueillzz, cueillez votre jeunesse... (+indices)

Un petit UP pour fêter les quelques heures restantes pour cette énigme... Il y a toujours des blocages, alors allons-y :

- A, C, G, T, tout le monde a vu de quoi il s'agit, je suppose. Maintenant, une fois ces belles séries de 0 et de 1 bien disposées, constatez ce qui suit : Spoiler : il y a toujours un seul 1 dans chaque colonne, soit pour A, soit pour C, soit pour G, soit pour T .

- pour l'étape suivante (transcription/traduction) : Spoiler : une seule étape de transcription suffit : GTA devient CAU, et non CAT puis GUA .

- 33 bases, donc Spoiler : 11 acides aminés , donc Spoiler : 11 lettres ... codées par quelqu'un qu'on commence à avoir beaucoup vu par ici wink pas bien dur, pas de décalage progressif ou quoi que ce soit, visez simple !

- pour la conclusion : Spoiler : pas celui de Cindy, celui du bonhomme que vous venez de croiser smile


Podcasts Modern Zeuhl : http://radio-r2r.fr/?p=298

 #22 - 08-05-2010 15:32:23

papiauche
Sa Sainteté
Enigmes résolues : 49
Messages : 2126

Malandrin, S03 E01 : Cuueillez, cueillez votre jeunesse... (+INDICES)

J'ai eu bien du mal, mais j'ai fini par y arriver.

BRUTUS donc.

CAT
GCT
GTT
CTG
CAG
CAA
CTA
CAC
CAT
GAC
GTC

donne

GUC    V
CGA    R
CAA    Q
GAC    D
GUC    V
GUU    V
GAU    D
GUG    V
GUA    V
CUG    L
CAG    Q


et SON ASSASSIN

De qui?

De César bien sûr. smile


"Je ne lis jamais un livre dont je dois faire la critique. On se laisse tellement influencer." O. Wilde

 #23 - 08-05-2010 17:04:20

moicestmoi
Elite de Prise2Tete
Enigmes résolues : 48
Messages : 1617
Lieu: Avec vous :-)

aMlandrin, S03 E01 : Cueillez, cueillez votre jeunesse... (+INDICES)

Joli comme tout, bien tarabiscoté et quand on voit les solutions, pas si difficile que ça !
Que veux-tu, la "blonde" n'a pas été capable de comprendre le premier décodage.. j'ose espérer faire mieux au prochain épisode smile


L'angle droit bout à 90 degrés.

 #24 - 08-05-2010 18:21:25

sosoy
Elite de Prise2Tete
Enigmes résolues : 49
Messages : 2365
Lieu: un peu d'ici... bcp d'ailleurs

malandrin, s03 e01 : cueillez, cyeillez votre jeunesse... (+indices)

je n'ai pas eu le temps de revérifier mes lettres hmm Mais t'aurai pu me le dire plus tôt enfoiré, que mes 11 lettres n'étaient pas les bonnes; évidemment que César ne donnait rien ^^ ... Mais bon, je te pardonne cool vivement la suite smile


Si j'étais payée à chaque connerie que je dis, je serais milliardaire.

 #25 - 08-05-2010 19:03:11

kosmogol
Banni
Enigmes résolues : 49
Messages : 11,928E+3

Malandrin, S03 E01 : Cueillez, cueillez otre jeunesse... (+INDICES)

Encore une que je ne sais pas faire !
Bravo, Mathias, joli travail.


http://enigmusique.blogspot.com/

Réponse rapide

Rédige ton message
| | | | Upload | Aide
:) :| :( :D :o ;) :/ :P :lol: :mad: :rolleyes: :cool:
Sécurité

Répondez (numériquement) à la petite énigme suivante : 

Dans une course, vous doublez le 31ème, en quelle position êtes-vous ?

Mots clés des moteurs de recherche

Mot clé (occurences)
Gif applaudissement (117) — Applaudissement gif (109) — Cindy crawford photos (73) — Brutus (54) — Applaudissement gif anime (53) — Gif anime applaudissement (38) — Thibault malandrin (30) — Applaudissements gif (27) — Gif applaudissements (18) — Cassandre prenom (14) — Gif anime applaudissements (14) — Cindy crawforf (11) — Gif applaudissement anime (11) — Photo de brutus (9) — Applaudissement (9) — Applaudissement .gif (9) — Prenom cassandre (8) — Malandrin (8) — Applaudissements (8) — Applaudissements gif anime (8) — Applaudissement anime (8) — Image de brutus (7) — Image brutus (6) — Nucleotides arn (6) — Cueillez cueillez votre jeunesse (6) — Code a une lettre acide amine (5) — 45 (5) — Cindy crawford (5) — Photo brutus (5) — Aligner roue decrypt (5) — Poeme prenom cassandra (5) — Cindy crawford 90 (5) — Vieux nichons (4) — Prenom aude (4) — 1-0 (4) — Synthese arn messager (4) — Gifs animes gratuits applaudissements (4) — Code cesar (4) — Cindy dejeux (4) — Poeme sur le prenom cassandra (4) — .gif anime (4) — Gifs animes applaudissements (4) — Gif applaudissement tumblr (4) — Mademoiselle hoche (3) — Cindy crawford jeune photos (3) — Noms des filles avec la lettre n (3) — Poeme cassandra (3) — Poeme avec le prenom de carla (3) — Gifle .gif (3) — Image gif applaudissement (3) — Arnmessager (3) — Cindy crawford video (3) — Cueillez cueillez (3) — Cyndi crawford (3) — Cindy crawford 22 ans (3) — Gifs animes applaudissement (3) — Gifs applaudissements (3) — Image avec prenom cassandra (3) — Ceuillez votre jeunesse (3) — La traduction de l arn (2) — Les bases azotees de l arn (2) — Brutus popeye images (2) — Traduction arn messager (2) — Prenom cassandre en texte (2) — Www.enigmemalandrin.com (2) — Poeme avec les lettre du prenom dominique (2) — Blouson nb2 (2) — Cindy crawford corps (2) — Photos videos cindy crawford (2) — Images gif anime applaudissement (2) — Couteau brutus (2) — Exercice code cesar (2) — Cueillez cueillez votre jeunesse que veut dire (2) — Traduction arnm (2) — Ep initiales (2) — Que veut dire cueillez cueillez votre jeunesse (2) — Popeye agenouille (2) — Etapes de la traduction de l arn messager (2) — Cindy avale (2) — Ode a cassandre (2) — Cindy crawford photo (2) — Paul prenom (2) — Prenom cassandre fille (2) — Gif applaudissement gratuit (2) — Poeme avec le prenom amine (2) — Image code cesar* (2) — Applaudissement gif tumblr (2) — Cours de 1er s sequence en acide amine (2) — Applaudissements gift (2) — Brutus popeye .gif (2) — Reputation .gif (2) — Applaudissements n gif (2) — Latex assassin (2) — Nom-prenom.com (cassandre) (2) — Brutus .gif (2) — Cindy crawford nb (2) — Geraldine guc (2) — Images de brutus (2) — Indice de jeunesse manche (2) — Applaudissement blonde gif (2) — Www.cyndy croford photo (2) — Cindy crawford grande image (2) — Cassandra le prenom (2) — Tableau comparaison adn arn messager (2) — Tu me manque (images en .gif) (2) — Lettre a la jeunesse commencant par jeunesse jeunesse sois humaine (2) — Y a t il un ordre des bases azote cytosine thymine (2) — Gif anime de gifle (2) — Cindy longuere (2) — Gif image bravo! (2) — J te succe les nichons (2) — Cindy crawforf photo (2) — Images applaudissements (2) — Feu anime .gif (2) — Animation gif applaudissement (2) — Applaudissements en gif animes (2) — Cindy le boucher (2) — Tableau ode a cassandre (2) — Poeme tu va me manquer (2) — Expression cueillez cueillez votre jeunesse. (2) — Latex fonte manuscrite ligature (2) — Arn pre messager a arn messager (2) — Une lettre a fille elle me manque (2) — Arn messager (2) — Gif anime applaudir (2) — Acides amines serie l (2) — Que signifie le prenom cassandra texte (2) — Brutus image (2) — Poeme avec le prenom thibault (2) — Photo applaudissement (2) — Cassandre le prenom (2) — Inspecteur gadjo (2) — Prenom cassandra (2) — Popeye et brutus (2) — Applaudissement gifs (2) — Cassandra prenom (2) — Wikipedia ode a cassandre (2) — Texte a trou poisson (1) — Bravo gif (1) — Poesie avec le prenom aude (1) — Cindy thibault (1) — Que signifie cueillez votre jeunesse (1) — Image manquer qq (1) — Image prenom cassandre (1) — Cueillez votre jeunesse est la traduction (1) — Poesie de prenom (1) — Un malandrin h (1) — Les deux font la paire +enigme (1) — 1+1=0 (1) — Cat--gua--valine (1) — Photode cindy by dominique (1) — Poeme avec lettre prenom y (1) — Cyndi croford (1) — Mps code cesar (1) — Brutus et popei (1) — Gifs animes brillantes (1) — C est quoi cueillez notre jeunesse (1) — Gifs anime applaudissement (1) — Www.45 (1) — Texte de cesar en latin (1) — Poeme avec prenom (1) — Images brutus (1) — Cindy le disez (1) — Production ecrite sur cueillez votre jeunesse (1) — Cyndie crawford jeune (1) — Applaudir gifs animes tumblr (1) — Cindy crawford naked (1) — Cueillez cueillez votre jeunesse* (1) — Poeme avec prenom cassandra (1) — Aplaudissement image gif (1) — Poeme avec le nom aude (1) — Traduire en logique les phrases suivantes les assassins de cesar sont des amis de brutus (1) — Exercice de mathematique avec un coktail de cindy (1) — Cyndi crawford ses plus belles photos (1) — Base g c a t degeneree (1) — Siffle .gif (1) — Poeme sur le prenom camille (1) — Poeme avec prenom camille (1) — Cindy crawford chez elle (1) — Enigme gif anime (1) — Enigme expression representee par g a (1) — Poeme des prenom adeline (1) — Cueillez cueillez votre jeunesse + qu est-ce ca vaut dire (1) — Poeme sur le prenom cassandre (1) — Cueillez cueillez votre jeunesse qu est ce que ca veut dire? (1) — Cindy crawford hot (1) — Gif tumblr applaudir (1) — Brutus popey (1) — Vieille lettre manuscrite (1) — Cyndi crawford sexy (1) — Aligner roue decrypt assassin 6=1 (1) — Photo cindy crawford cheveux court (1) — Thibault malandrin ses cheveux (1) — Date d?chiffrer les instructions (1) — Nom: (r)qqsssssssss (1)_001_001.jpg (1) — Blonde qui montre ses seins .gif (1) — Lettre du prenom cassandra (1) — Poeme avec lettre du prenom camille (1) — Cindy crawford panties (1) — Code genetique+chiffrement +enigmes (1) — Ah gua (1) — Texte sur le prenom cassandre (1) — Cassandra sonassian (1) — Poeme pour cassandra (1) — Image applaudissement gif (1) — Www.cindycarwford.com (1) — Mon sourire tu as derobe tel un malandrin (1) — Poeme sur le prenom marine en colonne (1) — Gifs animes du prenom cassandre (1) — La transcription de cueillez (1) — Aude et cindy (1) — Cuillez vous votre jeunesse (1) — Applaudir gif animado (1) — Cindy crawford 17 ans (1) — Photo de prenom l ecole me manque (1) — Lettre je te pardonne (1) — Dominique gau (1) — Poeme avec les lettre du prenom (1) — Cindy courbe (1) — Poeme avec les lettre du prenom cassandra (1) — Tout les prenoms de filles chloe (1) — Cindy crawford pic (1) — Chasse au tresor avec +enigmes video (1) — Qu est-ce que ca veut dire cueillez cueillez votre jeunesse (1) — Prenom aude lettre (1) — Acgt adn en binaire (1) — Cueillez cueillez votre jeunesse wikipedia (1) — Www.amazing pictures (1) — Xxi guc (1) — Cueillez cueillez votre jeunesse analyse (1) — Ceuillez cueillez jeune (1) — Brutus et popeye (1) — Http://brutus/ (1) — Aude est un prenom de fille (1) — Poeme avec le prenom adeline (1) — Decodeur d enigme assassin (1) — Aplaudissement gif (1) — Cindy crawford taille (1) — Poemes prenoms cassandra (1) — Mon tout est un criminel (1) — Devinette avec prenom cassandra (1) — Cindi crawforf (1) — Poeme avec les lettres du prenom camille (1) — Poeme qui commence par les lettres des prenoms (1) — Poesies sur le prenoms dominique (1) — La duree de vie d un arn messagers (1) — Applaudir .gif anime (1) — Crawford (1) — Comme par magie s03e01 (1) — Google pompier cua (1) — Brutus popeye (1) — Immage de brutus (1) — Enigme suicide couteau enfonce dans le dos (1) — Cueillez la jeunesse wikipedia francais (1) — Poesie avec des prenoms cassander (1) — .gif seins (1) — Cyndie croford photos (1) — Image de prenom cassandre (1) — Code lettre enigme (1) — Meuf qui se touch .gif (1) — Code binaire 0 1 (1) — Tu cu cua mi fili (1) — Docteur a. cueillez (1) — Applaudissement tumblr (1) — Www.amazing photos (1) — Codon gug (1) — Poeme avec le prenom paul (1) — Gif tumblr applaudissement (1) — Poesie avec lettre de son prenom de seconde (1) — Inspecteur manix (1) — Gifs animes gratuits applaudissement (1) — Poeme avec les lettre du prenom : cassandre (1) — Poesie cassandra (1) — Prenom cassandra avec logo de coeur (1) — Code acide amine degenere rond (1) — Il me manque poeme (1) — Cindy ode (1) — Applaudissements images (1) — Que signifie cueillez cueillez votre jeunesse ? (1) — Enfoncer une porte ouverte gif (1) — Poeme a une personne qui nous manque (1) — Photos de cingy crawford de nos jours (1) — Poeme avec cassandra (1) — Brutus bravo popeye (1) — Codons (1) — Image animee applaudissement pour mail (1) — Image applaudissement (1) — Fame cu pr latex (1) — Cindy crawford vieille (1) — Cindy crawford pics (1) — Cueillezcueillez votre jeunesse... (1) — Cindy croford (1) — Poeme prenom aude (1) — Black and white cindy crawford (1) — Poemeavec prenom dominique femme (1) — Que veut dire ceuillez votre jeunesse (1) — Que veut dire <<cueillez votre jeunesse>> (1) — Amine juste un oui (1) — Cindy hoche (1) — Cueuillez cueuillez votre jeunesse avant (1) — Applaudissements anime (1) — Thibault malandrin cheveux (1) — Poeme il me manque (1) — Petites colonnes (1) — Cueillez votre jeunesse avant que (1) —

Pied de page des forums

P2T basé sur PunBB
Screenshots par Robothumb

© Copyright 2002–2005 Rickard Andersson

Prise2Tete Forum Statistiques Liste des membres Hall of Fame Contact
© Prise2tete - Site d'énigmes et de réflexion.
Un jeu où seules la réflexion, la logique et la déduction permettent de trouver la solution.

Flux RSS de Prise2Tete Forum Jeux & Prise2Tete Test & Prise2Tete Partenariat et Publicité sur Prise2Tete